WO1998033917A1 - Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof - Google Patents
Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof Download PDFInfo
- Publication number
- WO1998033917A1 WO1998033917A1 PCT/US1998/001973 US9801973W WO9833917A1 WO 1998033917 A1 WO1998033917 A1 WO 1998033917A1 US 9801973 W US9801973 W US 9801973W WO 9833917 A1 WO9833917 A1 WO 9833917A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vegf
- polypeptide
- vegfr
- ofthe
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
Definitions
- VASCULAR ENDOTHELIAL GROWTH FACTOR C PROTEIN AND GENE, MUTANTS THEREOF, AND USES THEREOF
- the present invention generally relates to the field of genetic engineering and more particularly to growth factors for endothelial cells and growth factor genes.
- vasculogenesis Major embryonic blood vessels are believed to arise via vasculogenesis, whereas the formation ofthe rest ofthe vascular tree is thought to occur as a result of vascular sprouting from pre-existing vessels, a process called angiogenesis, Risau et al, Devel. Biol., 725:441-450 (1988).
- Endothelial cells give rise to several types of functionally and morphologically distinct vessels. When organs differentiate and begin to perform their specific functions, the phenotypic heterogeneity of endothelial cells increases. Upon angiogenic stimulation, endothelial cells may re-enter the cell cycle, migrate, withdraw from the cell cycle and subsequently differentiate again to form new vessels that are functionally adapted to their tissue environment. Endothelial cells undergoing angiogenesis degrade the underlying basement membrane and migrate, forming capillary sprouts that project into the perivascular stroma. Ausprunk et al, Microvasc. Rev., 74:51-65 (1977).
- Angiogenesis during tissue development and regeneration depends on the tightly controlled processes of endothelial cell proliferation, migration, differentiation, and survival. Dysfunction ofthe endothelial cell regulatory system is a key feature of many diseases. Most significantly, tumor growth and metastasis have been shown to be angiogenesis dependent. Folkman et al, J. Biol. Chem., 267: 10931-10934 (1992). Key signals regulating cell growth and differentiation are mediated by polypeptide growth factors and their transmembrane receptors, many of which are tyrosine kinases.
- Fibroblast growth factors are also known to be involved in the regulation of angiogenesis. They have been shown to be mitogenic and chemotactic for cultured endothelial cells. Fibroblast growth factors also stimulate the production of proteases, such as coUagenases and plasminogen activators, and induce tube formation by endothelial cells. Saksela et al, Ann. Rev. Cell Biol, :93-126 (1988). There are two general classes of fibroblast growth factors, FGF-1 and FGF-2, both of which lack conventional signal peptides.
- FGF-2 is bound to heparin sulfate proteoglycans in the subendothelial extracellular matrix from which it may be released after injury.
- Heparin potentiates the stimulation of endothelial cell proliferation by angiogenic FGFs, both by protecting against denaturation and degradation and dimerizing the FGFs.
- Cultured endothelial cells express the FGF-1 receptor but no significant levels of other high-affinity fibroblast growth factor receptors.
- TGF ⁇ Transforming growth factor ⁇
- HGF Hepatocyte growth factor
- VEGF vascular endothelial growth factor
- PDGF vascular endothelial growth factor
- Other reported effects of VEGF include the mobilization of intracellular calcium, the induction of plasminogen activator and plasminogen activator inhibitor- 1 synthesis, stimulation of hexose transport in endothelial cells, and promotion of monocyte migration in vitro.
- VEGF vascular endothelial growth factor
- VEGF121 and VEGF 165 are secreted in a soluble form, whereas the isoforms of 189 and 206 amino acid residues remain cell surface-associated and have a strong affinity for heparin.
- VEGF was originally purified from several sources on the basis of its mitogenic activity toward endothelial cells, and also by its ability to induce microvascular permeability, hence it is also called vascular permeability factor (VPF).
- VPF vascular permeability factor
- Two high affinity receptors for VEGF have been characterized: VEGFR-
- VEGF receptors occurs mainly in vascular endothelial cells, although some may be present on hematopoietic progenitor cells, monocytes, and melanoma cells.
- VEGFR-1 and VEGFR-2 show different responses.
- PIGF placenta growth factor
- VEGFR-1 VEGFR-1 with high affinity.
- PIGF was able to enhance the growth factor activity of VEGF, but it did not stimulate endothelial cells on its own.
- Naturally occurring VEGF/P1GF heterodimers were nearly as potent mitogens as VEGF homodimers for endothelial cells. Cao et al, J. Biol. Chem., 277:3154-62 (1996).
- Flt4 receptor tyrosine kinase (VEGFR-3) is closely related in structure to the products ofthe VEGFR-1 and VEGFR-2 genes. Despite this similarity, the mature form of Flt4 differs from the VEGF receptors in that it is proteolytically cleaved in the extracellular domain into two disulfide-linked polypeptides. Pajusola et al, Cancer Res., 52:5738-5743 (1992). The 4.5 and 5.8 kb Flt4 mRNAs encode polypeptides which differ in their C-termini due to the use of alternative 3' exons. Isoforms of VEGF or PIGF do not show high affinity binding to Flt4 or induce its autophosphorylation. Expression of Flt4 appears to be more restricted than the expression of
- VEGFR-1 or VEGFR-2 The expression of Flt4 first becomes detectable by in situ hybridization in the angioblasts of head mesenchyme, the cardinal vein, and extraembryonically in the allantois of 8.5 day p.c. mouse embryos. In 12.5 day p.c. embryos, the Flt4 signal is observed in developing venous and presumptive lymphatic endothelia, but arterial endothelia appear negative. During later stages of development, Flt4 mRNA becomes restricted to developing lymphatic vessels. The lymphatic endothelia and some high endothelial venules express Flt4 mRNA in adult human tissues and increased expression occurs in lymphatic sinuses in metastatic lymph nodes and in lymphangioma. These results support the theory ofthe venous origin of lymphatic vessels. Five endothelial cell specific receptor tyrosine kinases, Flt-1 (VEGFR-1),
- VEGFR-2 KDR/Flk-1
- Flt4 VEGFR-3
- Tie Flt4
- Tek/Tie-2 KDR/Flk-1
- Targeted mutations inactivating Flt-1, Flk-1, Tie, and Tek in mouse embryos have indicated their essential and specific roles in vasculogenesis and angiogenesis at the molecular level.
- VEGFR-1 and VEGFR-2 bind VEGF with high affinity (K d 16 pM and 760 pM, respectively) and VEGFR-1 also binds the related placenta growth factor (PIGF; K d about 200 pM).
- PIGF placenta growth factor
- the present invention provides a ligand, designated VEGF-C, for the Flt4 receptor tyrosine kinase (VEGFR-3).
- the invention provides a purified and isolated polypeptide which is capable of binding to the Flt4 receptor tyrosine kinase.
- an Flt4 ligand ofthe invention is capable of stimulating tyrosine phosphorylation of Flt4 receptor tyrosine kinase in a host cell expressing the Flt4 receptor tyrosine kinase.
- Preferred ligands ofthe invention are mammalian polypeptides. Highly preferred ligands are human polypeptides.
- dimers and multimers comprising polypeptides ofthe invention linked to each other or to other polypeptides are specifically contemplated as aspects ofthe invention.
- an Flt4 ligand polypeptide has a molecular weight of approximately 23 kD as determined by SDS-PAGE under reducing conditions.
- the invention includes a ligand composed of one or more polypeptides of approximately 23 kD which is purifyable from conditioned media from a PC-3 prostatic adenocarcinoma cell line, the cell line having ATCC Ace. No. CRL 1435. Amino acid sequencing of this PC-3 cell-derived ligand polypeptide revealed that the ligand polypeptide comprises an amino terminal amino acid sequence set forth in SEQ ID NO: 5.
- the present invention also provides a new use for the PC-3 prostatic adenocarcinoma cell line which produces an Flt4 ligand.
- the ligand may be purified and isolated directly from the PC-3 cell culture medium.
- the ligand polypeptide comprises a fragment ofthe amino acid sequence shown in SEQ ID NO: 8 which binds with high affinity to the human Flt4 receptor tyrosine kinase.
- high affinity in the context of a polypeptide ligand of a receptor tyrosine kinase, typically reflects a binding relationship characterized by sub-nanomolar dissociation constants (K d ), as reported herein for VEGF-C binding to VEGFR-2 and VEGFR-3, and reported elsewhere in the art for the binding of VEGF, PIGF, PDGF, and other factors to their receptors.
- Exemplary fragments include: a polypeptide comprising an amino acid sequence set forth in SEQ ED NO: 8 from about residue 112 to about residue 213; a polypeptide comprising an amino acid sequence from about residue 104 to about residue 227 of SEQ ID NO: 8; and a polypeptide comprising an amino acid sequence from about residue 112 to about residue 227 of SEQ ID NO: 8.
- polypeptides comprising amino acid sequences of SEQ ID NO: 8 that span, approximately, the following residues: 31-213, 31-227, 32-227, 103-217, 103-225, 104-213, 113-213, 103-227, 113-227, 131-211, 161-211, 103-225, 227-419, 228-419, 31-419, and 1-419, as described in greater detail below.
- the present invention also provides one or more polypeptide precursors of an Flt4 ligand, wherein one such precursor (designated "prepro- VEGF-C”) comprises the complete amino acid sequence (amino acid residues 1 to 419) shown in SEQ ID NO: 8.
- the invention includes a purified and isolated polypeptide having the amino acid sequence of residues 1 to 419 shown in SEQ JD NO: 8.
- Ligand precursors according to the invention when expressed in an appropriate host cell, produce, via cleavage, a polypeptide which binds with high affinity to the Flt4 receptor tyrosine kinase.
- a putative 102 amino acid leader (prepro) peptide has been identified in the amino acid sequence shown in SEQ ID NO: 8.
- the invention includes a purified and isolated polypeptide having the amino acid sequence of residues 103-419 shown in SEQ ID NO: 8.
- an expressed Flt4 ligand polypeptide precursor is proteolytically cleaved upon expression to produce an approximately 23 kD Flt4 ligand polypeptide.
- an Flt4 ligand polypeptide is provided which is the cleavage product of the precursor polypeptide shown in SEQ ID NO: 8 and which has a molecular weight of approximately 23 kD under reducing conditions.
- VEGF-C precursors/processing products consisting of polypeptides with molecular weights of about 29 and 32 kD also are considered aspects of the invention.
- an expressed Flt4 ligand polypeptide precursor is proteolytically cleaved upon expression to produce an approximately 21 kD VEGF-C polypeptide. Sequence analysis has indicated that an observed 21 kD form has an amino terminus approximately 9 amino acids downstream from the amino terminus ofthe 23 kD form, suggesting that alternative cleavage sites exist.
- an aspect ofthe invention includes a fragment ofthe purified and isolated polypeptide having the amino acid sequence of residues 1 to 419 shown in SEQ ID NO: 8, the fragment being capable of binding with high affinity to Flt4 receptor tyrosine kinase.
- Preferred embodiments include fragments having an apparent molecular weight of approximately 21/23 kD and 29/32 kD as assessed by SDS-PAGE under reducing conditions.
- the invention includes a purified and isolated polypeptide that is a VEGF-C of vertebrate origin, wherein the VEGF-C has a molecular weight of about 21-23 kD, as assessed by SDS-PAGE under reducing conditions, and wherein the VEGF-C is capable of binding to Flt4 receptor tyrosine kinase (VEGFR-3).
- Vertebrate VEGF-C forms of about 30-32 kD that are capable of binding VEGFR-3 also are intended as an aspect ofthe invention.
- a preferred Flt4 ligand comprises approximately amino acids 103- 227 of SEQ ID NO: 8.
- VEGF-C mutational analysis described herein indicates that a naturally occurring VEGF-C polypeptide spanning amino acids 103-227 of SEQ ID NO: 8, produced by a natural processing cleavage that defines the C-terminus, exists and is biologically active as an Flt4 ligand.
- polypeptide fragment consisting of residues 104- 213 of SEQ ID NO: 8 has been shown to retain VEGF-C biological activity. Additional mutational analyses indicate that a polypeptide spanning only amino acids 113-213 of SEQ ID NO: 8 retains Flt4 ligand activity. Accordingly, preferred polypeptides comprise sequences spanning, approximately, amino acid residues 103-227, 104-213, or 113-213, of SEQ ID NO: 8.
- sequence comparisons of members ofthe VEGF family of polypeptides provide an indication that still smaller fragments will retain biological activity, and such smaller fragments are intended as aspects ofthe invention.
- eight highly conserved cysteine residues ofthe VEGF family of polypeptides define a region from residue 131 to residue 211 of SEQ ID NO: 8 (see Figures 2, 5 & 10); therefore, a polypeptide spanning from about residue 131 to about residue 211 is expected to retain VEGF-C biological activity.
- VEGF-C polypeptides are shown herein to bind and activate KDR/flk-1 receptor tyrosine kinase (VEGFR-2).
- the invention includes a purified and isolated polypeptide that is capable of binding to at least one of KDR receptor tyrosine kinase (VEGFR-2) and Flt4 receptor tyrosine kinase (VEGFR-3), the polypeptide comprising a portion ofthe amino acid sequence in SEQ ID NO: 8 effective to permit such binding.
- the portion ofthe amino acid sequence in SEQ ID NO: 8 is a continuous portion having as its amino terminal residue an amino acid between residues 102 and 161 of SEQ ID NO: 8 and having as its carboxy terminal residue an amino acid between residues 210 and 228 of SEQ ID NO: 8.
- the portion has, as its amino terminal residue, an amino acid between residues 102 and 131 of SEQ ID NO: 8.
- the portion ofthe amino acid sequence in SEQ ID NO: 8 is a continuous portion having as its amino terminal residue an amino acid between residues 102 and 114 of SEQ ID NO: 8 and having as its carboxy terminal residue an amino acid between residues 212 and 228 of SEQ ID NO: 8.
- Polypeptides ofthe invention which bind to and activate a receptor are useful for stimulating VEGF-C biological activities that are mediated through the receptor.
- Polypeptides ofthe invention which bind to but do not activate a receptor are useful for inhibiting VEGF-C activities mediated through that receptor.
- the definition of polypeptides ofthe invention is intended to include within its scope variants thereof.
- polypeptide variants contemplated include purified and isolated polypeptides having amino acid sequences that differ from the exact amino acid sequences of such polypeptides (e.g., VEGF-C, VEGF-C precursors and VEGF-C fragments) by conservative substitutions, as recognized by those of skill in the art, that are compatible with the retention of at least one VEGF-C biological activity or VEGF-C- inhibitory activity ofthe polypeptide.
- polypeptides e.g., VEGF-C, VEGF-C precursors and VEGF-C fragments
- variants when used to refer to polypeptides, also is intended to include polypeptides having amino acid additions, including but not limited to additions of a methionine and/or leader sequence to promote translation and/or secretion; additions of peptide sequences to facilitate purification (e.g., polyhistidine sequences and/or epitopes for antibody purification); and additions of polypeptide-encoding sequences to produce fusion proteins with VEGF-C.
- variants also is intended to include polypeptides having amino acid deletions at the amino terminus, the carboxy terminus, or internally of amino acids that are non-conserved amongst the human, mouse, and quail VEGF-C sequences taught herein, and that are compatible with the retention ofthe VEGF-C or VEGF-C-inhibitory activity ofthe polypeptide to which the deletions have been made.
- variants also is intended to include polypeptides having modifications to one or more amino acid residues that are compatible with retaining VEGF-C or VEGF-C inhibitory activity ofthe polypeptide.
- glycosylations identical or different to glycosylations of native VEGF-C
- substituents e.g., labels, compounds to increase serum half-life (e.g., polyethylene glycol), and the like.
- polypeptides ofthe invention include certain fragments that have been observed to result from the processing of prepro- VEGF-C into mature VEGF-C.
- the invention includes a purified and isolated polypeptide having a molecular weight of about 29 kD as assessed by SDS-PAGE under reducing conditions and having an amino acid sequence consisting essentially of a portion of SEQ ID NO: 8 having residue 228 of SEQ ID NO: 8 as its amino terminal amino acid residue; and a purified and isolated polypeptide having a molecular weight of about 15 kD as assessed by SDS-PAGE under reducing conditions and having an amino acid sequence consisting essentially of a portion of SEQ ED NO: 8 having residue 32 of SEQ ID NO: 8 as its amino terminal amino acid residue.
- Such polypeptides are expected to modulate VEGF-C biological activity through their interactions with VEGF-C receptors and/or interactions with biologically active VEGF-C.
- VEGF-C Some ofthe conserved cysteine residues in VEGF-C participate in interchain disulfide bonding to make homo- and heterodimers ofthe various naturally occurring VEGF-C polypeptides. Beyond the preceding considerations, evidence exists that VEGF-C polypeptides lacking interchain disulfide bonds retain VEGF-C biological activity. Consequently, the materials and methods ofthe invention include all VEGF-C fragments that retain at least one biological activity of VEGF-C, regardless ofthe presence or absence of interchain disulfide bonds. The invention also includes multimers (including dimers) comprising such fragments linked to each other or to other polypeptides.
- Fragment linkage may be by way of covalent bonding (e.g., disulfide bonding) or non- covalent bonding of polypeptide chains (e.g, hydrogen bonding, bonding due to stable or induced dipole-dipole interactions, bonding due to hydrophobic or hydrophilic interactions, combinations of these bonding mechanisms, and the like).
- the invention includes a purified and isolated polypeptide multimer, wherein at least one monomer thereof is a polypeptide that is capable of binding to VEGFR-2 and/or VEGFR-3, the polypeptide comprising a portion ofthe amino acid sequence in SEQ DD NO: 8 effective to permit such binding, and wherein the multimer itself is capable of binding to VEGFR-2 and/or VEGFR-3.
- the multimer has at least one VEGF-C biological activity as taught herein.
- at least one monomer ofthe multimer is a polypeptide from another member ofthe PDGF/VEGF family of proteins, e.g., a vascular endothelial growth factor (VEGF) polypeptide, a vascular endothelial growth factor B (VEGF-B) polypeptide, a platelet derived growth factor A (PDGF-A) polypeptide, a platelet derived growth factor B (PDGF-B) polypeptide, a c-fos induced growth factor (FIGF) polypeptide, or a placenta growth factor (PIGF) polypeptide.
- VEGF vascular endothelial growth factor
- VEGF-B vascular endothelial growth factor B
- PDGF-A platelet derived growth factor A
- PDGF-B platelet derived growth factor B
- FIGF platelet derived growth factor
- PIGF placenta growth factor
- the multimer ofthe invention is a dimer of two monomer polypeptides.
- the invention includes a dimer wherein each monomer thereof is capable of binding to at least one of VEGFR-2 and VEGFR-3 and has an amino acid sequence comprising a portion of SEQ DD NO: 8 effective to permit such binding. Dimers having covalent attachments and dimers wherein the two monomers are free of covalent attachments to each other are contemplated.
- the invention includes analogs ofthe polypeptides of the invention.
- analog refers to polypeptides having alterations involving one or more amino acid insertions, internal amino acid deletions, and/or non-conservative amino acid substitutions (replacements).
- the definition of analog is intended to include within its scope variants of analog polypeptides embodying such alterations.
- mutant when used with respect to polypeptides herein, is intended to refer generically to VEGF-C variants, VEGF-C analogs, and variants of VEGF-C analogs.
- Preferred analogs possess at least 90% amino acid sequence similarity to the native peptide sequence from which the analogs were derived. Highly preferred analogs possess 95%, 96%, 97%, 98%, 99%, or greater amino acid sequence similarity to the native peptide sequence.
- the invention includes a polypeptide analog of a VEGF-C of vertebrate origin that is capable of binding to VEGFR-3 (e.g., an analog of a vertebrate VEGF-C of about 21-23 kD as assessed by SDS-PAGE under reducing conditions), wherein an evolutionarily conserved cysteine residue in the VEGF-C has been deleted or replaced, and wherein the analog is capable of binding to VEGFR-3 and has reduced VEGFR-2 binding affinity relative to the wildtype VEGF-C.
- VEGFR-3 e.g., an analog of a vertebrate VEGF-C of about 21-23 kD as assessed by SDS-PAGE under reducing conditions
- the determination that a residue is "evolutionarily conserved" is made solely by reference to the alignment of human, mouse, and quail VEGF-C sequences provided herein and aligned to show similarity in Fig. 5.
- the presence ofthe same residue in all three sequences indicates that the residue is evolutionarily conserved, notwithstanding the fact that VEGF-C from other species may lack the residue.
- the conserved cysteine residue corresponds to the cysteine at position 156 of SEQ DD NO: 8.
- cysteine at position 156 is readily determined from an analysis ofthe vertebrate VEGF-C sequence of interest, since the cysteine at position 156 of SEQ DD NO: 8 (human VEGF-C) falls within an evolutionarily conserved portion of VEGF-C (see Fig. 5, comparing human, mouse, and quail VEGF-C polypeptides). Alignment of human VEGF-C allelic variants, other mammalian VEGF-C polypeptides, and the like with the three VEGF-C forms in Fig. 5 will identify that cysteine which corresponds to the cysteine at position 156 of SEQ DD NO: 8, even if the allelic variant has greater or fewer than exactly 155 residues preceding the cysteine of interest.
- the invention includes a purified polypeptide that is an analog of human VEGF-C and that is capable of binding to at least one of Flt-1 receptor tyrosine kinase (VEGFR-1), KDR receptor tyrosine kinase (VEGFR-2), and Flt4 receptor tyrosine kinase (VEGFR-3).
- Flt-1 receptor tyrosine kinase VAGFR-1
- VEGFR-2 KDR receptor tyrosine kinase
- Flt4 receptor tyrosine kinase VEGFR-3
- VEGFR-3 has reduced VEGFR-2 binding affinity, as compared to the VEGFR-2 binding affinity of a wildtype human VEGF-C (e.g., as compared to the VEGFR-2 binding affinity of a human VEGF-C having an amino acid sequence consisting essentially of amino acids 103-227 of SEQ DD NO: 8).
- a wildtype human VEGF-C e.g., as compared to the VEGFR-2 binding affinity of a human VEGF-C having an amino acid sequence consisting essentially of amino acids 103-227 of SEQ DD NO: 8.
- VEGF-C ⁇ 156 polypeptides VEGF-C ⁇ 156 polypeptides.
- VEGF-C ⁇ C, 56 polypeptide is meant an analog wherein the cysteine at position 156 of SEQ DD NO: 8 has been deleted or replaced by another amino acid.
- a VEGF-C ⁇ C 155 polypeptide analog can be made from any VEGF-C polypeptide ofthe invention that comprises all of SEQ DD NO: 8 or a portion thereof that includes position 156 of SEQ DD NO: 8.
- the VEGF-C ⁇ C 156 polypeptide analog comprises a portion of SEQ DD NO: 8 effective to permit binding to VEGFR-3.
- the invention includes a VEGF-C ⁇ C 156 polypeptide that binds VEGFR-3, has reduced VEGFR-2 binding affinity, and has an amino acid sequence which includes amino acids 131 to 211 of SEQ DD NO: 8, wherein the cysteine residue at position 156 of SEQ DD NO: 8 has been deleted or replaced.
- the VEGF-C ⁇ C 156 polypeptide comprises a continuous portion of SEQ DD NO: 8, the portion having as its amino terminal residue an amino acid between residues 102 and 114 of SEQ DD NO: 8, and having as its carboxy terminal residue an amino acid between residues 212 and 228 of SEQ DD NO: 8, wherein the cysteine residue at position 156 of SEQ DD NO: 8 has been deleted or replaced.
- the cysteine residue at position 156 of SEQ DD NO: 8 has been replaced by a serine residue.
- VEGF-C ⁇ R 226 ⁇ R 227 polypeptides A second family of human VEGF-C analogs that bind VEGFR-3 but have reduced VEGFR-2 binding affinity are VEGF-C ⁇ R 226 ⁇ R 227 polypeptides.
- VEGF-C ⁇ R 226 ⁇ R 227 polypeptide is meant an analog wherein the arginine residues at positions 226 and 227 of SEQ DD NO: 8 have been deleted or replaced by other amino acids, for the purpose of eliminating a proteolytic processing site ofthe carboxy terminal pro-peptide of VEGF-C.
- the VEGF-C ⁇ R 226 ⁇ R 227 polypeptide comprises a portion of SEQ DD NO: 8 effective to permit binding of VEGFR-3.
- the invention includes a VEGF-C ⁇ R 226 ⁇ R 227 polypeptide having an amino acid sequence comprising amino acids 112-419 of SEQ DD NO: 8, wherein the arginine residues at positions 226 and 227 of SEQ DD NO: 8 have been deleted or replaced.
- a VEGF-C ⁇ R 226 ⁇ R 227 polypeptide wherein the arginine residues at positions 226 and 227 of SEQ ID NO: 8 have been replaced by serine residues.
- VEGF-C basic polypeptide is meant a VEGF-C analog wherein at least one amino acid having a basic side chain has been introduced into the VEGF-C coding sequence, to emulate one or more basic residues in VEGF (e.g., residues Arg 108 , Lys 110 , and His 112 in the VEGF 165 precursor shown in Fig. 2) that have been implicated in VEGF receptor binding.
- VEGF-C basic polypeptide is meant a VEGF-C analog wherein at least one amino acid having a basic side chain has been introduced into the VEGF-C coding sequence, to emulate one or more basic residues in VEGF (e.g., residues Arg 108 , Lys 110 , and His 112 in the VEGF 165 precursor shown in Fig. 2) that have been implicated in VEGF receptor binding.
- two or three basic residues are introduced into VEGF-C.
- positions 187, 189, and 191 of SEQ DD NO: 8 are preferred positions to introduce basic residues.
- the invention includes a VEGF-C bas,c polypeptide that is capable of binding to at least one of VEGFR-1, VEGFR-2, and VEGFR-3, and that has an amino acid sequence comprising residues 131 to 211 of SEQ DD NO: 8, wherein the glutamic acid residue at position 187, the threonine residue at position 189, and the proline residue at position 191 of SEQ ID NO: 8 have been replaced by an arginine residue, a lysine residue, and a histidine residue, respectively.
- VEGF-C structural information is employed to create useful analogs of VEGF.
- mature VEGF-C contains an unpaired cysteine (position 137 of SEQ DD NO: 8) and is able to form non-covalently bonded polypeptide dimers.
- a VEGF analog is created wherein this unpaired cysteine residue from mature VEGF-C is introduced at an analogous position of VEGF (e.g., introduced in place of Leu 58 ofthe human VEGF165 precursor (Fig. 2, Genbank Ace. No. M32977).
- Such VEGF analogs are termed VEGF +cys polypeptides.
- the invention includes a human VEGF analog wherein a cysteine residue is introduced in the VEGF amino acid sequence at a position selected from residues 53 to 63 ofthe human VEGF 165 precursor having the amino acid sequence set forth in SEQ DD NO: 56.
- a cysteine residue is introduced in the VEGF amino acid sequence at a position selected from residues 53 to 63 ofthe human VEGF 165 precursor having the amino acid sequence set forth in SEQ DD NO: 56.
- At least four naturally occurring VEGF isoforms have been described, and VEGF +cys polypeptide analogs of each isoform are contemplated.
- the cysteine is introduced at a position in a VEGF isoform which corresponds to position 58 ofthe VEGF 165 precursor having the amino acid sequence set forth in SEQ DD NO: 56.
- the present invention also provides purified and isolated polynucleotides (i.e., nucleic acids) encoding all ofthe polypeptides ofthe invention, including but not limited to cDNAs and genomic DNAs encoding VEGF-C precursors, VEGF-C, and biologically active fragments thereof, and DNAs encoding VEGF-C variants and VEGF-C analogs.
- a preferred nucleic acid ofthe invention comprises a DNA encoding amino acid residues 1 to 419 of SEQ DD NO: 8 or one ofthe aforementioned fragments or analogs thereof.
- a preferred polynucleotide according to the invention comprises the human VEGF-C cDNA sequence set forth in SEQ DD NO: 7 from nucleotide 352 to 1611.
- Other polynucleotides according to the invention encode a VEGF-C polypeptide from, e.g., mammals other than humans, birds (e.g., avian quails), and others.
- Still other polynucleotides ofthe invention comprise a coding sequence for a VEGF-C fragment, and allelic variants of those DNAs encoding part or all of VEGF-C.
- polynucleotides ofthe invention comprise a coding sequence for a VEGF-C variant or a VEGF-C analog.
- Preferred variant-encoding and analog-encoding polynucleotides comprise the human, mouse, or quail VEGF-C cDNA sequences disclosed herein (e.g., nucleotides 352-1611 of SEQ DD NO: 7 or continuous portions thereof) wherein one or more codon substitutions, deletions, or insertions have been introduced to create the variant/analog-encoding polynucleotide.
- a preferred polynucleotide encoding a VEGF-C ⁇ C 156 polypeptide comprises all or a portion of SEQ DD NO: 7 wherein the cysteine codon at positions 817-819 has been replaced by a codon encoding a different amino acid (e.g., a serine-encoding TCC codon).
- the invention further comprises polynucleotides that hybridize to the aforementioned polynucleotides under standard stringent hybridization conditions.
- Exemplary stringent hybridization conditions are as follows: hybridization at 42 C C in 50% formamide, 5X SSC, 20 mM Na » PO 4 , pH 6.8; and washing in 0.2X SSC at 55°C. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide content ofthe sequences to be hybridized. Formulas standard in the art are appropriate for determining appropriate hybridization conditions. See Sambrook et al, Molecular Cloning: A Laboratory Manual (Second ed., Cold Spring Harbor Laboratory Press, 1989) ⁇ 9.47-9.51.
- polynucleotides capable of hybridizing to polynucleotides encoding VEGF-C, VEGF-C fragments, or VEGF-C analogs, are useful as nucleic acid probes for identifying, purifying and isolating polynucleotides encoding other (non-human) mammalian forms of VEGF-C and human VEGF-C allelic variants. Additionally, these polynucleotides are useful in screening methods ofthe invention, as described below.
- nucleic acids useful as probes ofthe invention comprise nucleic acid sequences of at least about 16 continuous nucleotides of SEQ DD NO: 7. More preferably, these nucleic acid probes would have at least about 20 continuous nucleotides found in SEQ DD NO: 7. In using these nucleic acids as probes, it is preferred that the nucleic acids specifically hybridize to a portion ofthe sequence set forth in SEQ DD NO: 7. Specific hybridization is herein defined as hybridization under standard stringent hybridization conditions.
- nucleic acid probes preferably are selected such that they fail to hybridize to genes related to VEGF-C (e.g., fail to hybridize to human VEGF or to human VEGF-B genes).
- the invention comprehends polynucleotides comprising at least about 16 nucleotides wherein the polynucleotides are capable of specifically hybridizing to a gene encoding VEGF-C, e.g., a human gene.
- the specificity of hybridization ensures that a polynucleotide ofthe invention is able to hybridize to a nucleic acid encoding a VEGF-C under hybridization conditions that do not support hybridization ofthe polynucleotide to nucleic acids encoding, e.g., VEGF or VEGF-B.
- polynucleotides of at least about 16 nucleotides, and preferably at least about 20 nucleotides are selected as continuous nucleotide sequences found in SEQ DD NO: 7 or the complement ofthe nucleotide sequence set forth in SEQ DD NO: 7.
- the invention includes polynucleotides having at least 90 percent (preferably at least 95 percent, and more preferably at least 97, 98, or 99 percent) nucleotide sequence identity with a nucleotide sequence encoding a polypeptide ofthe invention.
- the polynucleotides have at least 95 percent sequence identity with a nucleotide sequence encoding a human VEGF-C precursor (such as the VEGF-C precursor in SEQ DD NO: 8 and allelic variants thereof), human VEGF-C, or biologically active VEGF-C fragments.
- Additional aspects ofthe invention include vectors which comprise nucleic acids ofthe invention; and host cells transformed or transfected with nucleic acids or vectors ofthe invention.
- Preferred vectors ofthe invention are expression vectors wherein nucleic acids ofthe invention are operatively connected to appropriate promoters and other control sequences that regulate transcription and/or subsequent translation, such that appropriate prokaryotic or eukaryotic host cells transformed or transfected with the vectors are capable of expressing the polypeptide encoded thereby (e.g., the VEGF-C, VEGF-C fragment, VEGF-C variant, or VEGF-C analog encoded thereby).
- a preferred vector ofthe invention is plasmid pFLT4-L, having ATCC accession no. 97231. Such vectors and host cells are useful for recombinantly producing polypeptides ofthe invention, including VEGF-C, and fragments, variants, and analogs thereof.
- host cells such as procaryotic and eukaryotic cells, especially unicellular host cells, are modified to express polypeptides of the invention.
- Host cells may be stably transformed or transfected with isolated DNAs of the invention in a manner allowing expression of polypeptides ofthe invention therein.
- the invention further includes a method of making polypeptides ofthe invention.
- a nucleic acid or vector ofthe invention is expressed in a host cell, and a polypeptide ofthe invention is purified from the host cell or the host cell's growth medium.
- the invention includes a method of making a polypeptide capable of specifically binding to VEGFR-1, VEGFR-2 and/or VEGFR-3, comprising the steps of: (a) transforming or transfecting a host cell with a nucleic acid ofthe invention; (b) cultivating the host cell to express the nucleic acid; and (c) purifying a polypeptide capable of specifically binding to VEGFR-1, VEGFR-2, and/or VEGFR-3 from the host cell or from the host cell's growth media.
- the invention also includes purified and isolated polypeptides produced by methods ofthe invention.
- the invention includes a human VEGF-C polypeptide or biologically active fragment, variant, or analog thereof that is substantially free of other human polypeptides.
- host cells may be modified by activating an endogenous VEGF-C gene that is not normally expressed in the host cells or that is expressed at a lower rate than is desired.
- Such host cells are modified (e.g., by homologous recombination) to express the VEGF-C by replacing, in whole or in part, the naturally- occurring VEGF-C promoter with part or all of a heterologous promoter so that the host cells express VEGF-C.
- the heterologous promoter DNA is operatively linked to the VEGF-C coding sequences, i.e., controls transcription ofthe VEGF-C coding sequences. See, for example, PCT International Publication No.
- heterologous promoter DNA amplifiable marker DNA e.g., ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydro-orotase
- intron DNA may be recombined along with the heterologous promoter DNA into the host cells.
- the invention includes, for example, a cell comprising a nucleic acid having a sequence encoding human VEGF-C and further comprising a non- VEGF-C promoter sequence (i.e., a heterologous promoter sequence) or other non- VEGF-C control sequence that increases RNA transcription in the cell ofthe sequence encoding human VEGF-C.
- a non- VEGF-C promoter sequence i.e., a heterologous promoter sequence
- other non- VEGF-C control sequence that increases RNA transcription in the cell ofthe sequence encoding human VEGF-C.
- the DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout” strategies [see, Capecchi, Science, 244: 1288-1292 (1989)], of rodents that fail to express functional VEGF-C or that express a VEGF-C fragment, variant, or analog. Such rodents are useful as models for studying the activities of VEGF-C and VEGF-C modulators in vivo.
- the invention includes an antibody that specifically binds to one or more polypeptides ofthe invention, and/or binds to polypeptide multimers ofthe invention.
- the term "specifically binds" is intended to exclude antibodies that cross-react with now-identified, related growth factors, such as VEGF, VEGF-B, PDGF-A, PDGF-B, FIGF, and PIGF.
- VEGF-C polypeptides of different species due to the high level of amino acid similarity shared by VEGF-C polypeptides of different species, it will be understood that antibodies that specifically bind to human VEGF-C polypeptides ofthe invention will, in many instances, also bind non-human (e.g., mouse, quail) VEGF-C polypeptides ofthe invention.
- Antibodies both monoclonal and polyclonal, may be made against a polypeptide ofthe invention according to standard techniques in the art. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988)).
- Standard protein manipulation techniques and recombinant techniques also may be employed to generate humanized antibodies and antigen-binding antibody fragments and other chimeric antibody polypeptides, all of which are considered antibodies ofthe invention.
- the invention further includes hybridoma cells that produce antibodies ofthe invention or other cell types that have been genetically engineered to express antibody polypeptides ofthe invention.
- Antibodies ofthe invention may be used in diagnostic applications to monitor angiogenesis, vascularization, lymphatic vessels and their disease states, wound healing, or certain tumor cells, hematopoietic, or leukemia cells.
- the antibodies also may be used to block the ligand from activating its receptors; to purify polypeptides ofthe invention; and to assay fluids for the presence of polypeptides ofthe invention.
- the invention further includes immunological assays (including radio-immuno assays, enzyme linked immunosorbent assays, sandwich assays and the like) which employ antibodies ofthe invention.
- Ligands according to the invention may be labeled with a detectable label and used to identify their corresponding receptors in situ.
- Labeled Flt4 ligand and anti- Flt4 ligand antibodies may be used as imaging agents in the detection of lymphatic vessels, high endothelial venules and their disease states, and Flt4 receptors expressed in histochemical tissue sections.
- the ligand or antibody may be covalently or non-covalently coupled to a suitable supermagnetic, paramagnetic, electron dense, echogenic, or radioactive agent for imaging.
- Other, non-radioactive labels, such as biotin and avidin may also be used.
- a related aspect ofthe invention is a method for the detection of specific cells, e.g., endothelial cells. These cells may be found in vivo, or in ex vivo biological tissue samples.
- the method of detection comprises the steps of contacting a biological tissue comprising, e.g., endothelial cells, with a polypeptide according to the invention which is capable of binding to VEGFR-2 and/or VEGFR-3, under conditions wherein the polypeptide binds to the cells, optionally washing the biological tissue, and detecting the polypeptide bound to the cells in the biological tissue, thereby detecting the cells.
- polypeptides ofthe invention are useful for detecting and/or imaging cells that express both VEGFR-2 and VEGFR-3, whereas other polypeptides (e.g., VEGF-C ⁇ C, 56 polypeptides) are useful for imaging specifically those cells which express VEGFR-3.
- VEGF-C vascular endothelial cells
- promoting growth of lymphatic endothelial cells and lymphatic vessels increasing vascular permeability
- myelopoiesis e.g., growth of neutrophilic granulocytes
- VEGF-C and precursor, fragment, variant, and analog polypeptides that retain one or more VEGF-C biological activities are useful agonists for stimulating the desired biological activity; whereas precursor, fragment, variant, and analog polypeptides that are capable of binding to VEGFR-2 and/or VEGFR-3 (either alone or as a homo- or hetero-dimer with other polypeptides) without stimulating receptor-mediated VEGF-C activity (i.e., without activating the receptor) are useful as antagonists (inhibitors) of VEGF-C.
- antibodies ofthe invention that bind biologically active VEGF-C forms and thereby interfere with VEGF-C-receptor interactions are useful as inhibitors of VEGF-C.
- Antisense oligonucleotides comprising a portion ofthe VEGF-C coding sequence and/or its complement also are contemplated as inhibitors ofthe invention. Both biologically active polypeptides and inhibitor polypeptides ofthe invention have utilities in various imaging applications.
- the biological effects of VEGF-C on vascular endothelial cells indicate in vivo uses for polypeptides ofthe invention for stimulating angiogenesis (e.g., during wound healing, in tissue transplantation, in eye diseases, in the formation of collateral vessels around arterial stenoses and into injured tissues after infarction) and for inhibiting angiogenesis (e.g., to inhibit tumor growth and/or metastatic cancer).
- the biological effects on vascular endothelial cells indicate in vitro uses for biologically active forms of VEGF-C to promote the growth of (including proliferation of) cultured vascular endothelial cells and precursors thereof.
- VEGF-C The biological effects of VEGF-C on lymphatic endothelia indicate in vivo uses for polypeptides ofthe invention for stimulating lymphangiogenesis (e.g., to promote re-growth or permeability of lymphatic vessels in, for example, organ transplant patients; to mitigate the loss of axillary lymphatic vessels following surgical interventions in the treatment of cancer (e.g., breast cancer); to treat aplasia ofthe lymphatic vessels or lymphatic obstructions) and for inhibiting it (e.g., to treat lymphangiomas).
- Additional in vivo uses for polypeptides ofthe invention include the treatment or prevention of inflammation, edema, elephantiasis, and Milroy's disease.
- the biological effects on lymphatic endothelial cells indicate in vitro uses for biologically active forms of VEGF-C to promote the growth of cultured lymphatic endothelial cells and precursors thereof.
- the invention includes a method of modulating (stimulating/increasing or inhibiting/decreasing) the growth of vertebrate endothelial cells or vertebrate endothelial precursor cells comprising contacting such endothelial cells or precursor cells with a polypeptide or antibody (or antigen-binding portion thereof) ofthe invention, in an amount effective to modulate the growth ofthe endothelial or endothelial precursor cells.
- Mammalian endothelial cells and their precursors are preferred. Human endothelial cells are highly preferred. In one embodiment, the endothelial cells are lymphatic endothelial cells. In another embodiment, the cells are vascular endothelial cells.
- the method may be an in vitro method (e.g., for cultured endothelial cells) or an in vivo method. The in vitro growth modulation of CD34+ endothelial precursor cells [see, e.g., Asahara et al, Science, 275:964-967 (1997)] isolated from peripheral blood, bone marrow, or cord blood is specifically contemplated.
- a pharmaceutical composition comprising the polypeptide formulated in a pharmaceutically acceptable diluent, adjuvant, excipient, carrier, or the like
- a pharmaceutical composition comprising the polypeptide formulated in a pharmaceutically acceptable diluent, adjuvant, excipient, carrier, or the like
- the endothelial cells are lymphatic endothelial cells
- the polypeptide is one that has reduced effect on the permeability of mammalian blood vessels compared to a wildtype VEGF-C polypeptide (e.g., compared with VEGF-C having an amino acid sequence set forth in SEQ DD NO: 8 from residue 103 to residue 227).
- VEGF-C ⁇ C, 56 polypeptides are contemplated for use in this embodiment.
- the invention contemplates the modulation of endothelial cell-related disorders.
- Endothelial cell disorders contemplated by the invention include, but are not limited to, physical loss of lymphatic vessels (e.g., surgical removal of axillary lymph tissue), lymphatic vessel occlusion (e.g., elephantiasis), and lymphangiomas.
- the subject, and endothelial cells are human.
- the endothelial cells may be provided in vitro or in vivo, and they may be contained in a tissue graft.
- polypeptides ofthe invention may be used to stimulate lymphocyte production and maturation, and to promote or inhibit trafficking of leukocytes between tissues and lymphatic vessels or to affect migration in and out ofthe thymus.
- the biological effects of VEGF-C on myelopoiesis indicate in vivo and in vitro uses for polypeptides ofthe invention for stimulating myelopoiesis (especially growth of neutrophilic granuloctyes) or inhibiting it.
- the invention includes a method for modulating myelopoiesis in a mammalian subject comprising administering to a mammalian subject in need of modulation of myelopoiesis an amount of a polypeptide or antibody (or antigen-binding portion thereof) ofthe invention that is effective to modulate myelopoiesis.
- a mammalian subject suffering from granulocytopenia is selected, and the method comprises administering to the subject an amount of a polypeptide effective to stimulate myelopoiesis.
- a polypeptide ofthe invention is administered in an amount effective to increase the neutrophil count in blood ofthe subject.
- Preferred subjects are human subjects.
- An effective amount of a polypeptide is an amount of polypeptide empirically determined to be necessary to achieve a reproducible change in the production of neutrophilic granulocytes (as determined by microscopic or macroscopic visualization and estimation of cell doubling time, or nucleic acid synthesis assays), as would be understood by one of ordinary skill in the art.
- the invention includes a method of increasing the number of neutrophils in the blood of a mammalian subject comprising the step of expressing in a cell in a subject in need of an increased number of blood neutrophils a DNA encoding a VEGF-C protein, the DNA operatively linked to a non- VEGF-C promoter or other non- VEGF-C control sequence that promotes expression ofthe DNA in the cell.
- the invention includes a method of modulating the growth of neutrophilic granulocytes in vitro or in vivo comprising the step of contacting mammalian stem cells with a polypeptide or antibody ofthe invention in an amount effective to modulate the growth of mammalian endothelial cells.
- the invention includes a method for modulating the growth of CD34+ progenitor cells (especially hematopoietic progenitor cells and endothelial progenitor cells) in vitro or in vivo comprising the step of contacting mammalian CD34+ progenitor cells with a polypeptide or antibody ofthe invention in an amount effective to modulate the growth of mammalian endothelial cells.
- CD34+ progenitor cells isolated from cord blood or bone marrow are specifically contemplated.
- in vitro and in vivo methods ofthe invention for stimulating the growth of CD34+ precursor cells also include methods wherein polypeptides ofthe invention are employed together (simultaneously or sequentially) with other polypeptide factors for the purpose of modulating hematopoiesis/myelopoiesis or endothelial cell proliferation.
- CSFs colony stimulating factors
- G-CSF granulocyte-CSF
- M-CSF macrophage-CSF
- GM-CSF granulocyte-macrophage-CSF
- IL-3 interleukin-3
- SCF stem cell factor
- VEGF vascular endothelial growth factor
- a polypeptide ofthe invention as a progenitor cell or myelopoietic cell growth factor or co-factor with one or more ofthe foregoing factors may potentiate previously unattainable myelopoietic effects and/or potentiate previously attainable myelopoietic effects while using less ofthe foregoing factors than would be necessary in the absence of a polypeptide ofthe invention.
- compositions comprising polypeptides ofthe invention in admixture with one or more ofthe factors identified in the previous paragraph.
- Preferred compositions further comprise a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier.
- kits comprising (a) at least one polypeptide ofthe invention packaged with (b) one or more of the foregoing polypeptides (e.g., in unit dosage form, but not in admixture with each other).
- polypeptides or antibodies ofthe invention will be administered in any suitable manner using an appropriate pharmaceutically-acceptable vehicle, e.g., a pharmaceutically-acceptable diluent, adjuvant, excipient or carrier.
- an appropriate pharmaceutically-acceptable vehicle e.g., a pharmaceutically-acceptable diluent, adjuvant, excipient or carrier.
- the invention further includes compositions, e.g., pharmaceutical compositions, comprising one or more polypeptides or antibodies ofthe invention.
- composition that may be administered to a mammalian host, e.g., orally, topically, parenterally (including subcutaneous injections, intravenous, intramuscular, intracisternal injection or infusion techniques), by inhalation spray, or rectally, in unit dosage formulations containing conventional non-toxic carriers, diluents (e.g., calcium carbonate, sodium carbonate, lactose, calcium phosphate, sodium phosphate, kaolin, water), adjuvants, vehicles, and the like, including but not limited to flavoring agents, preserving agents; granulating and disintegrating agents; binding agents; time delay materials; oils; suspending agents; dispersing or wetting agents; anti-oxidants; emulsifiers, etc.
- diluents e.g., calcium carbonate, sodium carbonate, lactose, calcium phosphate, sodium phosphate, kaolin, water
- the invention further provides a method of using a polypeptide ofthe invention for the manufacture of a medicament for use in any ofthe foregoing methods.
- the invention further provides a method of using a polypeptide ofthe invention for the manufacture of a medicament for the treatment of any ofthe foregoing indicated conditions and disease states.
- Such methods optionally involve the use of additional biologically active ingredients (e.g., VEGF, PIGF, G-CSF, etc.) for the manufacture ofthe medicament.
- additional biologically active ingredients e.g., VEGF, PIGF, G-CSF, etc.
- Effective amounts of polypeptides for the foregoing methods are empirically determined using standard in vitro and in vivo dose-response assays.
- experimental data provided herein provide guidance as to amounts of polypeptides ofthe invention that are effective for achieving a desired biological response.
- the dissociation constants determined for one form of mature VEGF-C provide an indication as to the concentration of VEGF-C necessary to achieve biological effects, because such dissociation constants represent concentrations at which half of the VEGF-C polypeptide is bound to the receptors through which VEGF-C biological effects are mediated.
- Polypeptides ofthe invention also may be used to quantify future metastatic risk by assaying biopsy material for the presence of active receptors or ligands in a binding assay.
- a binding assay may involve the use of a detectably labeled polypeptide ofthe invention or of an unlabeled polypeptide in conjunction with a labeled antibody, for example. Kits comprising such substances are included within the scope ofthe invention.
- the present invention also provides methods for using the claimed nucleic acids (i.e., polynucleotides) in screening for endothelial cell disorders.
- the invention provides a method for screening an endothelial cell disorder in a mammalian subject comprising the steps of providing a sample of endothelial cell nucleic acids from the subject, contacting the sample of endothelial cell nucleic acids with a polynucleotide ofthe invention which is capable of hybridizing to a gene encoding VEGF- C (and preferably capable of hybridizing to VEGF-C mRNA), determining the level of hybridization between the endothelial cell nucleic acids and the polynucleotide, and correlating the level of hybridization with a disorder.
- a preferred mammalian subject, and source of endothelial cell nucleic acids is a human.
- the disorders contemplated by the method of screening with polynucleotides include, but are not limited to, vessel disorders such as the aforementioned lymphatic vessel disorders, and hypoxia.
- Purified and isolated polynucleotides encoding other (non-human) VEGF-C forms also are aspects ofthe invention, as are the polypeptides encoded thereby, and antibodies that bind to non-human VEGF-C forms.
- Preferred non-human forms of VEGF- C are forms derived from other vertebrate species, including avian and mammalian species. Mammalian forms are highly preferred.
- the invention includes a purified and isolated mammalian VEGF-C polypeptide, and also a purified and isolated polynucleotide encoding such a polypeptide.
- the invention includes a purified and isolated polypeptide having the amino acid sequence of residues 1 to 415 of SEQ DD NO: 11, which sequence corresponds to a putative mouse VEGF-C precursor.
- the putative mouse VEGF-C precursor is believed to be processed into a mature mouse VEGF-C in a manner analogous to the processing ofthe human prepro-polypeptide.
- the invention includes a purified and isolated polypeptide capable of binding with high affinity to an Flt4 receptor tyrosine kinase (e.g., a human or mouse Flt-4 receptor tyrosine kinase), the polypeptide comprising a fragment ofthe purified and isolated polypeptide having the amino acid sequence of residues 1 to 415 of SEQ DD NO: 11, the fragment being capable of binding with high affinity to the Flt4 receptor tyrosine kinase.
- the invention further includes multimers ofthe foregoing polypeptides and purified and isolated nucleic acids encoding the foregoing polypeptides, such as a nucleic acid comprising all or a portion ofthe sequence shown in SEQ DD NO: 10.
- the invention includes a purified and isolated quail VEGF-C polypeptide, biologically active fragments and multimers thereof, and polynucleotides encoding the foregoing polypeptides.
- VEGF-C polypeptides from other species may be altered in the manner described herein with respect to human VEGF-C variants, in order to alter biological properties ofthe wildtype protein. For example, elimination ofthe cysteine at position 152 of SEQ DD NO: 11 or position 155 of SEQ DD NO: 13 is expected to alter VEGFR-2 binding properties in the manner described below for human VEGF-C ⁇ C, 56 mutants.
- the invention includes a DNA comprising a VEGF-C promoter, that is capable of promoting expression of a VEGF-C gene or another operatively-linked, protein-encoding gene in native host cells, under conditions wherein VEGF-C is expressed in such cells.
- the invention includes a purified nucleic acid comprising a VEGF-C promoter sequence.
- Genomic clone lambda 5 described herein comprises more than 5 kb of human genomic DNA upstream ofthe VEGF-C translation initiation codon, and contains promoter DNA ofthe invention. Approximately 2.4 kb of this upstream sequence is set forth in SEQ DD NO: 48.
- the invention includes a purified nucleic acid comprising a portion of SEQ ED NO: 48, wherein the portion is capable of promoting expression of a protein encoding gene operatively linked thereto under conditions wherein VEGF-C is expressed in native host cells.
- the invention includes a chimeric nucleic acid comprising a VEGF-C promoter nucleic acid according to the invention operatively connected to a sequence encoding a protein other than a human VEGF-C.
- Figure 1 schematically depicts major endothelial cell receptor tyrosine kinases and growth factors involved in vasculogenesis and angiogenesis.
- Major structural domains are depicted, including immunoglobulin-like domains (IGH), epidermal growth factor homology domains (EGFH), fibronectin type III domains (FNIII), transmembrane (TM) and juxtamembrane (JM) domains, tyrosine kinase (TK1, TK2) domains, kinase insert domains (KI), and carboxy-terminal domains (CT).
- IGH immunoglobulin-like domains
- EGFH epidermal growth factor homology domains
- FNIII fibronectin type III domains
- JM transmembrane
- JM juxtamembrane
- TK1, TK2 tyrosine kinase domains
- KI kinase insert domains
- CT carboxy-termin
- Figure 2 shows a comparison ofthe deduced amino acid sequences of PDGF-A (SEQ DD NO: 53), PDGF-B (SEQ DD NO: 54), P1GF-1 (SEQ DD NO: 55), VEGF-B 167 (SEQ DD NO: 56), VEGF165 (SEQ DD NO: 57), and Flt4 ligand (VEGF-C, (SEQ DD NO: 8)).
- Figure 3 schematically depicts the VEGF-C promoter-reporter constructs and their activities in transfected HeLa cells.
- a restriction map of a portion of a genomic clone that includes the VEGF-C initiation codon and about 6 kb of upstream sequence is depicted above the constructs.
- Constructs were made linking putative VEGF-C promoter to the Luciferase reporter gene in pGL3 vector (Promega) and introduced into HeLa cells by calcium phosphate-mediated transfection method.
- the Luciferase activity obtained was compared to the level using the promoterless pGL3basic construct to obtain a measure of relative promoter activity. Luciferase activity is expressed graphically as a ratio of activity ofthe constructs versus this control.
- FIG. 4 graphically depicts the results of a competitive binding assay.
- VEGF 165 filled triangles: T
- wildtype VEGF-C filled circles: •
- VEGF-C mutants [VEGF-C R226,227S (open boxes: D); VEGF-C ⁇ N ⁇ CHis (open circles: O); and VEGF-C ⁇ N ⁇ CHisC156S (open triangles: ⁇ )] to compete with 125 I- VEGF-C ⁇ N ⁇ CHis for binding to VEGFR-2 and VEGFR-3 is shown.
- Figure 5 depicts the amino acid sequences of human (SEQ DD NO: 8), murine (SEQ DD NO: 11), and quail (SEQ ID NO: 13) VEGF-C polypeptides, aligned to show similarity. Residues conserved in all three species are depicted in bold.
- Figures 6A-C depict electrophoretic fractionations ofthe various forms of recombinant VEGF-C produced by transfected 293 EBNA cells.
- Figure 6B depicts the electrophoretic fractionation, under non-reducing conditions, of polypeptides produced from mock (M) transfected cells, cells transfected with wild type (wt) VEGF-C cDNA, and cells transfected with a cDNA encoding the VEGF-C mutant VEGF-C-R102S.
- M mock
- wt wild type
- FIG. 6A Fractionation of bands corresponding to wt VEGF-C are depicted in Figure 6A; fractionation of bands corresponding to the R102S mutant are depicted in Figure 6C.
- Figures 7A-B depict the forms and sizes of wild type and mutant recombinant VEGF-Cs, as revealed by non-reducing gel electrophoresis.
- Figure 7A shows the VEGF-C forms secreted into the media;
- Figure 7B shows the VEGF-C forms retained by the cells.
- Mock (M) transfected cells served as a control.
- Figures 8A-B present a comparison ofthe pattern of immunoprecipitated, labeled VEGF-C forms using antisera 882 and antisera 905. Adjacent lanes contain immunoprecipitates that were (lanes marked +) or were not (lanes marked -) subjected to reduction and alkylation.
- Fig. 9 is a schematic model ofthe proteolytic processing of VEGF-C.
- conserveed cysteine residues in the VEGF-homology domain are depicted with dots (for clarity, cysteine residues in the C- terminal propeptide are not marked).
- Putative sites of N-linked glycosylation are shown with Y symbols. Numbers indicate approximate molecular mass (kDa) ofthe corresponding polypeptide as measured by SDS-PAGE in reducing conditions.
- Disulfide bonds are marked as -S-S-; non-covalent bonds are depicted as dotted lines. A question mark indicates the presence of a possible non-covalent bond.
- the proteolytic generation of a small fraction of disulfide-linked 21 kDa forms is not indicated in the figure.
- Several intermediate forms also are omitted to simplify the scheme. Particularly, only one precursor polypeptide is cleaved initially. The figure is not intended to suggest that other intermediate forms, for example 21 kDa + 31 kDa, 31 kDa + 31 kDa + 29 kDa, do not exist.
- Figure 10 presents a comparison ofthe human and mouse VEGF-C amino acid sequences.
- the amino acid sequence of mouse VEGF-C is presented on the top line and differences in the human sequence are marked below it.
- An arrow indicates the putative cleavage site for the signal peptidase; BR3P motifs, as well as a CR/SC motif, are boxed; and conserved cysteine residues are marked in bold above the sequence.
- Arginine residue 158 is also marked in bold.
- the numbering refers to mouse VEGF-C residues.
- Figures 11 A and 1 IB depict the genomic structure ofthe human (11 A) and murine (1 IB) VEGF-C genes. Sequences of exon-intron junctions are depicted together with exon and intron lengths. Intron sequences are depicted in lower case letters. Nucleotides ofthe open reading frame observed in VEGF-C cDNAs are indicated as upper case letters in triplets (corresponding to the codons encoded at the junctions).
- Figure 12 depicts the exon-intron organization ofthe human VEGF-C gene. Seven exons are depicted as open boxes, with exon size depicted in base pairs. Introns are depicted as lines, with intron size (base pairs) depicted above the lines. 5' and 3' untranslated sequences of a putative 2.4 kb mature mRNA are depicted as shaded boxes. The location of genomic clones used to characterize the VEGF-C gene are depicted below the map ofthe gene.
- VEGF-C vascular endothelial growth factor
- VEGF-C also stimulates the migration of endothelial cells in collagen gel and induces vascular permeability in vivo. In transgenic mice, VEGF-C induces proliferation ofthe lymphatic endothelium and an causes an increase in neutrophilic granulocytes. Based on studies of VEGF-C variants and analogs and studies of VEGF precursors, it is anticipated that one or more VEGF-C precursors (the largest putative native VEGF-C precursor, excluding signal peptide, having the complete amino acid sequence from residue 32 to residue 419 of SEQ DD NO: 8) is capable of stimulating VEGFR-3.
- VEGF-C precursors the largest putative native VEGF-C precursor, excluding signal peptide, having the complete amino acid sequence from residue 32 to residue 419 of SEQ DD NO: 8
- the present application also provides significant guidance concerning portions ofthe VEGF-C amino acid sequence which are necessary for biological activity and portions (of one or more amino acids) which, when altered, will modulate (up-regulate or inhibit) VEGF-C biological activities.
- Such alterations are readily achieved through recombinant DNA and protein techniques, such as site-directed mutagenesis of a VEGF-C encoding cDNA and recombinant expression ofthe resultant modified cDNA.
- additional sequence may be expressed along with a sequence encoding a polypeptide having a desired biological activity, while retaining a desired biological activity ofthe protein.
- additional amino acids may be added at the amino terminus, at the carboxy-terminus, or as an insertion into the polypeptide sequence.
- deletion variants of a protein with a desired biological activity can be recombinantly expressed that lack certain residues ofthe endogenous/natural protein, while retaining a desired biological activity.
- recombinant protein variants may be produced having conservative amino acid replacements (including but not limited to substitution of one or more amino acids for other amino acids having similar chemical side-chains (acidic, basic, aliphatic, aliphatic hydroxyl, aromatic, amide, etc.)) which do not eliminate the desired biological activity of the protein. Accordingly, it is anticipated that such alterations of VEGF-C are VEGF-C equivalents within the scope ofthe invention.
- the putative prepro- VEGF-C has a deduced molecular mass of 46,883; a putative prepro- VEGF-C processing intermediate has an observed molecular weight of about 32 kD; and mature VEGF-C isolated from conditioned media has a molecular weight of about 23 kD as assessed by SDS-PAGE under reducing conditions.
- a major part ofthe difference in the observed molecular mass ofthe purified and recombinant VEGF-C and the deduced molecular mass ofthe prepro- VEGF-C encoded by the VEGF-C open reading frame (ORF) is attributable to proteolytic removal of sequences at the amino-terminal and carboxyl-terminal regions ofthe prepro- VEGF-C polypeptide.
- VEGF-C Extrapolation from studies ofthe structure of PDGF (Heldin et al, Growth Factors, 5:245-52 (1993)) suggests that the region critical for receptor binding and activation by VEGF-C is contained within amino acids residues 104-213, which are found in the secreted form ofthe VEGF-C protein (i.e., the form lacking the putative prepro leader sequence and some carboxyterminal sequences).
- the 23 kD polypeptide binding VEGFR-3 corresponds to a VEGF-homologous domain of VEGF-C.
- the nascent VEGF-C polypeptide may be glycosylated at three putative N- linked glycosylation sites identified in the deduced VEGF-C amino acid sequence.
- Polypeptides containing modifications, such as N-linked glycosylations, are intended as aspects ofthe invention.
- the carboxyl terminal amino acid sequences which increase the length of the VEGF-C polypeptide in comparison with other ligands of this family, show a pattern of spacing of cysteine residues reminiscent ofthe Balbiani ring 3 protein (BR3P) sequence (Dignam et al, Gene, 55:133-40 (1990); Paulsson et al, J. Mol. Biol, 277:331-49 (1990)).
- This novel C-terminal silk protein-like structural motif of VEGF-C may fold into an independent domain, which is cleaved off after biosynthesis.
- VEGF-C cysteine motif of the BR3P type is also found in the carboxyl terminus of VEGF.
- putative precursors and putative fully-processed VEGF-C were both detected in the cell culture media, suggesting cleavage by cellular proteases.
- the determination of amino-terminal and carboxy-terminal sequences of VEGF-C isolates was performed to identify the proteolytic processing sites.
- Antibodies generated against different parts ofthe pro- VEGF-C molecule were used to determine the precursor-product relationship and ratio, their cellular distribution, and the kinetics of processing and secretion.
- VEGF-C has a conserved pattern of eight cysteine residues, which may participate in the formation of intra- and interchain disulfide bonds, creating an antiparallel, dimeric, biologically active molecule, similar to PDGF. Mutational analysis ofthe cysteine residues involved in the interchain disulfide bridges has shown that, in contrast to PDGF, VEGF dimers need to be held together by these covalent interactions in order to maintain biological activity. Disulfide linking ofthe VEGF-C polypeptide chains was evident in the analysis of VEGF-C in nonreducing conditions, although recombinant protein also contained "fully processed" ligand-active VEGF-C forms which lacked disulfide bonds between the polypeptides. (See Fig. 9.)
- VEGFR-3 which distinguishes between VEGF and VEGF-C, is closely related in structure to VEGFR-1 and VEGFR-2.
- VEGFR-2 tyrosine kinase also is activated in response to VEGF-C.
- VEGFR-2 mediated signals cause striking changes in the morphology, actin reorganization and membrane ruffling of porcine aortic endothelial cells over-expressing this receptor.
- VEGFR-2 also mediated ligand-induced chemotaxis and mitogenicity.
- Waltenberger et al J. Biol. Chem., 269:26988-95 (1994).
- the receptor chimera CSF-lR/VEGFR-3 was mitogenic when ectopically expressed in NIH 3T3 fibroblastic cells, but not in porcine aortic endothelial cells (Pajusola et al, 1994).
- BCE bovine capillary endothelial cells, which express VEGFR-2 mRNA but very little or no VEGFR-1 or VEGFR-3 mRNAs, showed enhanced migration when stimulated with VEGF-C.
- VEGFR-3 The expression pattern of the VEGFR-3 (Kaipainen et al, Proc. Natl. Acad. Sci. (USA), 92:3566-70 (1995)) suggests that VEGF-C may function in the formation ofthe venous and lymphatic vascular systems during embryogenesis. Constitutive expression of VEGF-C in adult tissues shown herein further suggests that this gene product also is involved in the maintenance ofthe differentiated functions ofthe lymphatic and certain venous endothelia where VEGFR-3 is expressed (Kaipainen et al, 1995).
- VEGF-C Lymphatic capillaries do not have well-formed basal laminae and an interesting possibility exists that the silk-like BR3P motif is involved in producing a supramolecular structure which could regulate the availability of VEGF-C in tissues.
- VEGF-C also activates VEGFR-2, which is abundant in proliferating endothelial cells of vascular sprouts and branching vessels of embryonic tissues, but not so abundant in adult tissues. Millauer et al, Nature, 367:516-1% (1993). These data have suggested that VEGFR-2 is a major regulator of vasculogenesis and angiogenesis. VEGF-C may thus have a unique effect on lymphatic endothelium and a more redundant function, shared with
- VEGF in angiogenesis and possibly in regulating the permeability of several types of endothelia. Because VEGF-C stimulates VEGFR-2 and promotes endothelial migration, VEGF-C may be useful as an inducer of angiogenesis of blood and lymphatic vessels in wound healing, in tissue transplantation, in eye diseases, and in the formation of collateral vessels around arterial stenoses and into injured tissues after infarction.
- Previously-identified growth factors that promote angiogenesis include the fibroblast growth factors, hepatocyte growth factor/scatter factor, PDGF and TGF- ⁇ .
- fibroblast growth factors include the fibroblast growth factors, hepatocyte growth factor/scatter factor, PDGF and TGF- ⁇ .
- PDGF hepatocyte growth factor/scatter factor
- TGF- ⁇ TGF- ⁇ .
- VEGF has been the only growth factor relatively specific for endothelial cells.
- the newly identified factors VEGF-B [Olofsson et al, Proc. Natl. Acad.
- VEGF-C thus increase our understanding ofthe complexity ofthe specific and redundant positive signals for endothelial cells involved in vasculogenesis, angiogenesis, permeability, and perhaps also other endothelial functions.
- Expression studies using Northern blotting show abundant VEGF-C expression in heart and skeletal muscle; other tissues, such as placenta, ovary, small intestine, thyroid gland, kidney, prostate, spleen, testis and large intestine also express this gene.
- VEGF is predominantly expressed in the placenta
- VEGF-B and VEGF-C overlap in many tissues, which suggests that members ofthe VEGF family may form heterodimers and interact to exert their physiological functions.
- VEGFR-1 is necessary for the proper organization of endothelial cells forming the vascular endothelium
- VEGFR-2 is necessary for the generation of both endothelial and hematopoietic cells.
- the four genes ofthe VEGF family can be targets for mutations leading to vascular malformations or cardiovascular diseases.
- the following Examples illustrate preferred embodiments ofthe invention, wherein the isolation, characterization, and function of VEGF-C, VEGF-C variants and analogs, VEGF-C-encoding nucleic acids, and anti- VEGF-C antibodies according to the • invention are shown.
- Flt4 receptor tyrosine kinase VEGFR-3 cDNA
- Flt4 short form Flt4s
- Genbank Accession No. X68203 SEQ DD NO: 1
- Flt4 long form (Flt41)
- Flt41 Genbank Accession Nos. X68203 and S66407, SEQ DD NO: 2
- Flt4 expression vector designated pLTRFlt41 (encoding the long form of Flt4) was constructed using the pLTRpoly expression vector reported in Makela et al, Gene, 118: 293-294 (1992) (Genbank accession number X60280, SEQ DD NO: 3) and the Flt4 cDNAs, in the manner described in commonly-owned PCT patent application PCT/FI96/00427, filed August 01, 1996, published as PCT publication No. WO 97/05250 on 13 February 1997, and commonly-owned United States Patent Application Serial Nos. 08/671,573, filed June 28, 1996; 08/601,132, filed February 14, 1996; 08/585,895, filed January 12, 1996; and 08/510,133, filed August 1, 1995, all of which are incorporated by reference in their entirety.
- NTH 3T3 cells (60 % confluent) were co-transfected with 5 micrograms of the pLTRFlt41 construct and 0.25 micrograms ofthe pSV2neo vector containing the neomycin phosphotransferase gene (Southern et al, J. Mol. Appl. Genet., 7:327 (1982)), using the DOTAP liposome-based transfection reagents (Boehringer-Mannheim, Mannheim, Germany). One day after transfection, the cells were transferred into selection media containing 0.5 mg/ml geneticin (GD3CO, Grand Island, N.Y.). Colonies of geneticin-resistant cells were isolated and analyzed for expression ofthe Flt4 proteins.
- GD3CO 0.5 mg/ml geneticin
- the Flt4 cDNA fragment encoding the 40 carboxy-terminal amino acid residues ofthe Flt4 short form: NH2-PMTPTTYKG SVDNQTDSGM VLASEEFEQI ESRHRQESGFR-COOH (SEQ ED NO: 4) was cloned as a 657 bp EcoRI-fragment into the pG ⁇ X-l ⁇ T bacterial expression vector (Pharmacia- LKB, Inc., Uppsala, Sweden) in frame with the glutathione-S-transferase coding region.
- the resultant GST-Flt4S fusion protein was produced in E.
- a baculovirus expression vector was constructed to facilitate expression ofthe extracellular domain of Flt4 (Flt4 EC), as described in commonly-owned PCT patent application PCT/FI96/00427, filed August 01,
- the Flt4EC construct was transfected together with baculovirus genomic
- a human Flt4 ligand according to the invention was isolated from media conditioned by a PC-3 prostatic adenocarcinoma cell line (ATCC CRL 1435) in serum-free
- the ligand expressed by human PC-3 cells as characterized in Example 4 was purified and isolated using a recombinantly-produced Flt4 extracellular domain
- Flt4EC in affinity chromatography.
- the conditioned medium was clarified by centrifugation at 10,000 x g and concentrated 80-fold using an Ultrasette Tangential Flow Device (Filtron, Northborough, MA) with a 10 kD cutoff Omega Ultrafiltration membrane according to the manufacturer's instructions.
- Recombinant Flt4 extracellular domain was expressed in a recombinant baculovirus cell system and purified by affinity chromatography on Ni- agarose (Ni-NTA affinity column obtained from Qiagen). The purified extracellular domain was coupled to CNBr-activated Sepharose CL-4B at a concentration of 5 mg/ml and used as an affinity matrix for ligand affinity chromatography.
- Concentrated conditioned medium was incubated with 2 ml ofthe recombinant Flt4 extracellular domain-Sepharose affinity matrix in a rolling tube at room temperature for 3 hours. All subsequent purification steps were at +4 °C.
- the affinity matrix was then transferred to a column with an inner diameter of 15 mm and washed successively with 100 ml of PBS and 50 ml of 10 mM Na-phosphate buffer (pH 6.8). Bound material was eluted step-wise with 100 mM glycine-HCl, successive 6 ml elutions having pHs of 4.0, 2.4, and 1.9.
- the concentrated conditioned medium induced prominent tyrosine phosphorylation of Flt4 in transfected NTH 3T3 cells over-expressing Flt4. This activity was not observed in conditioned medium taken after medium was exposed to the Flt4 Sepharose affinity matrix.
- the specifically-bound Flt4-stimulating material was retained on the affinity matrix after washing in PBS, 10 mM Na-phosphate buffer (pH 6.8), and at pH 4.0. It was eluted in the first two 2 ml aliquots at pH 2.4. A further decrease ofthe pH ofthe elution buffer did not cause release of additional Flt4-stimulating material.
- Human poly(A) + RNA was isolated from five 15 cm diameter dishes of confluent PC-3 cells by a single step method using oligo(dT) (Type III, Collaborative Biomedical Products, Becton-Dickinson Labware, Bedford, MA) cellulose affinity chromatography (Sambrook et al, 1989). The yield was 70 micrograms. Six micrograms ofthe Poly(A) + RNA were used to prepare an oligo(dT)-primed cDNA library in the mammalian expression vector pcDNA I and the Librarian kit of Invitrogen according to the instructions included in the kit. The library was estimated to contain about 10 6 independent recombinants with an average insert size of approximately 1.8 kb.
- the amplified cDNA fragment was cloned into a pCR II vector (Invitrogen) using the TA cloning kit (Invitrogen) and sequenced using the radioactive dideoxynucleotide sequencing method of Sanger. Six clones were analyzed and all six clones contained the sequence encoding the expected peptide (amino acid residues 104-120 ofthe Flt4 ligand precursor, SEQ DD NO: 8).
- Nucleotide sequence spanning the region from the third nucleotide of codon 6 to the third nucleotide of codon 13 was identical in all six clones and thus represented an amplified product from the unique sequence encoding part ofthe amino terminus ofthe Flt4 ligand.
- That fragment was used as a probe for hybridization screening ofthe amplified PC-3 cell cDNA library.
- Filter replicas ofthe library were hybridized with the radioactively labeled probe at 42°C for 20 hours in a solution containing 50% formamide, 5x SSPE, 5x Denhardt's solution, 0.1% SDS and 0.1 mg/ml denatured salmon sperm DNA. Filters were washed twice in lx SSC, 0.1% SDS for 30 minutes at room temperature, then twice for 30 minutes at 65°C and exposed overnight.
- a complete human cDNA sequence and deduced amino acid sequence from a 2 kb clone is set forth in SEQ DD NOs: 7 and 8, respectively.
- a putative cleavage site of a "prepro" leader sequence is located between residues 102 and 103 of SEQ DD NO: 8.
- the predicted protein product of this reading frame was found to include a region homologous with the predicted amino acid sequences ofthe PDGF/VEGF family of growth factors, as shown in Fig. 2.
- Plasmid pFLT4-L containing the 2.1 kb human cDNA clone in pcDNAI vector, has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 20852 as accession number 97231.
- NotI restriction enzymes isolated from a preparative agarose gel, and ligated to the corresponding sites in the pREP7 expression vector (Invitrogen).
- the pREP7 vector containing the pFlt4-L insert was transfected into 293-EB ⁇ A cells (Invitrogen) using the calcium phosphate transfection method (Sambrook et al, 1989). About 48 hours after transfection, the medium ofthe transfected cells was changed to DMEM medium lacking fetal calf serum and incubated for 36 hours. The conditioned medium was then collected, centrifuged at 5000 x g for 20 minutes, the supernatant was concentrated 5-fold using
- MH 3T3 cells expressing LTRFlt41 the Flt4 receptor
- the cells were lysed, immunoprecipitated using anti-Flt4 antiserum and analyzed by Western blotting using anti-phosphotyrosine antibodies.
- the conditioned medium from two different dishes ofthe transfected cells stimulated Flt4 autophosphorylation in comparison with the medium from mock- transfected cells, which gave only background levels of phosphorylation ofthe Flt4 receptor.
- the deduced molecular weight of a polypeptide consisting ofthe complete amino acid sequence in SEQ DD NO: 8 is 46,883.
- the deduced molecular weight of a polypeptide consisting of amino acid residues 103 to 419 of SEQ DD NO: 8 is 35,881.
- the Flt4 ligand purified from PC-3 cultures had an observed molecular weight of about 23 kD as assessed by SDS-PAGE under reducing conditions. Thus, it appeared that the Flt4 ligand mRNA was translated into a precursor polypeptide, from which the mature ligand was derived by proteolytic cleavage.
- the Flt4 ligand may be glycosylated at three putative N-linked glycosylation sites conforming to the consensus which can be identified in the deduced Flt4 ligand amino acid sequence (N-residues underlined in Fig. 2).
- the carboxyl terminal amino acid sequences which increase the predicted molecular weight ofthe Flt4 ligand subunit in comparison with other ligands of this family, show a pattern of spacing of cysteine residues reminiscent ofthe Balbiani ring 3 protein (BR3P) sequence (Dignam et al, Gene, 55:133-140 (1990)).
- B3P Balbiani ring 3 protein
- Such a sequence may encode an independently folded domain present in a Flt4 ligand precursor and it may be involved, for example, in the regulation of secretion, solubility, stability, cell surface localization or activity ofthe Flt4 ligand.
- at least one cysteine motif of the BR3P type is also found in the VEGF carboxy terminal amino acid sequences.
- the Flt4 ligand mRNA appears first to be translated into a precursor from the mRNA corresponding to the cDNA insert of plasmid FLT4-L, from which the mature ligand is derived by proteolytic cleavage.
- the mature Flt4 ligand polypeptide one first expresses the cDNA clone (which is deposited in the pcDNAI expression vector) in cells, such as COS cells.
- VEGF-C polypeptide allows for identification ofthe amino-terminal proteolytic processing site. The determination ofthe amino-terminal sequence ofthe carboxyl-terminal propeptide will give the carboxyl-terminal processing site. This is confirmed by site- directed mutagenesis ofthe amino acid residues adjacent to the cleavage sites, which would prevent the cleavage.
- the Flt4 ligand is further characterizeable by progressive 3' deletions in the 3' coding sequences ofthe Flt4 ligand precursor clone, introducing a stop codon resulting in carboxy-terminal truncations of its protein product.
- the activities of such truncated forms are assayed by, for example, studying Flt4 autophosphorylation induced by the truncated proteins when applied to cultures of cells, such as NIH 3T3 cells expressing LTRFlt41.
- the difference between the molecular weights observed for the purified ligand and deduced from the open reading frame ofthe Flt4 ligand clone may be due to the fact that the soluble ligand was produced from an alternatively spliced mRNA which would also be present in the PC-3 cells, from which the isolated ligand was derived.
- To isolate such alternative cDNA clones one uses cDNA fragments ofthe deposited clone and PCR primers made according to the sequence provided as well as techniques standard in the art to isolate or amplify alternative cDNAs from the PC-3 cell cDNA library.
- Alternative cDNA sequences are determined from the resulting cDNA clones.
- Alternative exons can then be identified by a number of methods standard in the art, such as heteroduplex analysis of cDNA and genomic DNA, which are subsequently characterized.
- VEGF-C Flt4 ligand
- the blot was washed at room temperature for 2 x 30 minutes in 2x SSC containing 0.05% SDS, and then for 2 x 20 minutes at 52°C in 0. Ix SSC containing 0.1% SDS. The blot was then exposed at -70°C for three days using intensifying screens and Kodak XAR film. Both cell lines expressed an Flt4 ligand mRNA of about 2.4 kb, as well as VEGF and VEGF-B mRNAs.
- Expression products were labeled by the addition of 100 ⁇ Ci/ml of Pro-mixTM L-[ 35 S] in vitro cell labeling mix ((containing 35 S-methionine and 35 S-cysteine) Amersham, Buckinghamshire, England) to the culture medium devoid of cysteine and methionine. After two hours, the cell layers were washed twice with PBS and the medium was then replaced with DMEM-0.2% BSA.
- CM Conditioned medium
- PAE porcine aortic endothelial
- PAE-KDR cells (Waltenberger et al, 1994) were grown in Ham's F12 medium- 10% fetal calf serum (FCS). Confluent NTH 3T3-F 4 cells or PAE-KDR cells were starved overnight in DMEM or Ham's F12 medium, respectively, supplemented with 0.2%) bovine serum albumin (BSA), and then incubated for 5 minutes with the analyzed
- VEGF vascular endothelial growth factor
- PDGF-BB vascular endothelial growth factor-BB
- the cells were washed twice with ice-cold Tris-Buffered Saline (TBS) containing 100 mM sodium orthovanadate and lysed in RIPA buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.1 U/ml aprotinin and 1 mM sodium orthovanadate.
- TBS Tris-Buffered Saline
- PMSF phenylmethylsulfonyl fluoride
- the lysates were sonicated, clarified by centrifugation at
- Polypeptides were transferred to nitrocellulose by Western blotting and analyzed using PY20 phosphotyrosine-specific monoclonal antibodies (Transduction Laboratories) or receptor-specific antiserum and the ECL detection method (Amersham Corp.).
- PAE cells expressing VEGFR-2 were treated with 10- or 2-fold
- VEGFR-2 was immunoprecipitated with specific antibodies and analyzed by SDS-PAGE and Western blotting using phosphotyrosine antibodies. For comparison, the treatments were also carried out with non-conditioned medium containing 50 ng/ml of purified recombinant VEGF. Additional cells were also treated with VEGF-C- or VEGF- containing media pretreated with Flt4EC.
- VEGF-C expression vector encodes a ligand not only for Flt4 (VEGFR-3), but also for KDR/Flk-1 (VEGFR-2).
- PDGFR- ⁇ was immunoprecipitated with specific antibodies and analyzed by SDS-PAGE and Western blotting using phosphotyrosine antibodies with subsequent stripping and reprobing ofthe membrane with antibodies specific for PDGFR- ⁇ .
- a weak tyrosine phosphorylation of PDGFR- ⁇ was detected upon stimulation of Flt4-expressing NIH 3T3 cells with CM from the mock-transfected cells.
- a similar low level of PDGFR- ⁇ phosphorylation was observed when the cells were incubated with CM from the VEGF-C transfected cells, with or without prior treatment with Flt4EC.
- the addition of 50 ng/ml of PDGF-BB induced a prominent tyrosine autophosphorylation of PDGFR- ⁇ .
- VEGF-C Stimulates Endothelial Cell Migration In Collagen Gel
- CM Conditioned media
- BCE bovine capillary endothelial
- the collagen gels were prepared by mixing type I collagen stock solution (5 mg/ml in 1 mM HC1) with an equal volume of 2x MEM and 2 volumes of MEM containing 10% newborn calf serum to give a final collagen concentration of 1.25 mg/ml.
- the tissue culture plates (5 cm diameter) were coated with about 1 mm thick layer ofthe solution, which was allowed to polymerize at 37°C. BCE cells were seeded on top of this layer. For the migration assays, the cells were allowed to attach inside a plastic ring (1 cm diameter) placed on top ofthe first collagen layer.
- the number of cells migrating at different distances from the original area of attachment towards wells containing media conditioned by the non-transfected (control) or transfected (mock; VEGF-C; VEGF) cells were determined 6 days after addition ofthe media.
- the number of cells migrating out from the original ring of attachment was counted in five adjacent 0.5 mm x 0.5 mm squares using a microscope ocular lens grid and lOx magnification with a fluorescence microscope. Cells migrating further than 0.5 mm were counted in a similar way by moving the grid in 0.5 mm steps. The experiments were carried out twice with similar results.
- VEGF-C-containing CM stimulated cell migration more than medium conditioned by the non-transfected or mock-transfected cells but less than medium from cells transfected with a VEGF expression vector.
- Daily addition of 1 ng of FGF2 into the wells resulted in the migration of approximately twice the number of cells when compared to the stimulation by CM from VEGF-transfected cells.
- VEGF-C ⁇ N ⁇ CHis was shown to stimulate the incorporation of 3 H- thymidine into the DNA of BCE cells in a dose dependent manner (VEGF-C concentrations of 0, 10, 100, and 1000 pM tested). This data tends to confirm the observation, under light microscopy, that VEGF-C stimulates proliferation of these cells.
- Northern blots containing 2 micrograms of isolated poly(A) + RNA from multiple human tissues were probed with radioactively labeled insert ofthe 2.1 kb VEGF-C cDNA clone.
- Northern blotting and hybridization analysis showed that the 2.4 kb RNA and smaller amounts of a 2.0 kb mRNA are expressed in multiple human tissues, most prominently in the heart, placenta, muscle, ovary and small intestine, and less prominently in prostate, colon, lung, pancreas, and spleen.
- VEGF-C vascular endothelial growth factor-associated RNA
- a genomic PI plasmid for VEGF-C was isolated using specific primers and PCR and verified by Southern blotting and hybridization using a VEGF-C specific cDNA probe.
- the chromosomal localization of VEGF-C was further studied using metaphase FISH.
- PI probe for VEGF-C in FISH a specific hybridization to the 4q34 chromosomal band was detected in 40 out of 44 metaphases.
- Double-fluorochrome hybridization using a cosmid probe specific for the aspartylglucosaminidase (AGA) gene showed that VEGF-C is located just proximal to the AGA gene previously mapped to the 4q34-35 chromosomal band.
- AGA aspartylglucosaminidase
- Biotin-labeled VEGF-C PI and digoxigenin-labeled AGA cosmid probes were hybridized simultaneously to metaphase chromosomes. This experiment demonstrated that the AGA gene is more telomerically located than the VEGF-C gene.
- the foregoing example demonstrates the utility of polynucleotides ofthe invention as chromosomal markers and for the presence or absence ofthe VEGF-C gene region in normal or diseased cells.
- the VEGF-C locus at 4q34 is a candidate target for mutations leading to vascular malformations or cardiovascular diseases.
- C6 glioblastoma cells Confluent cultures of C6 cells (ATCC CCL 107) were grown on 10 cm diameter tissue culture plates containing 2.5 ml of DMEM and 5% fetal calf serum plus antibiotics. The cultures were exposed for 16 hours to normoxia in a normal cell culture incubator containing 5% CO 2 or hypoxia by closing the culture plates in an airtight glass chamber and burning a piece of wood inside until the flame was extinguished due to lack of oxygen.
- RNA Polyadenylated RNA was isolated (as in the other examples), and 8 micrograms ofthe RNA was electrophoresed and blot-hybridized with a mixture ofthe VEGF, VEGF-B and VEGF-C probes.
- the results show that hypoxia strongly induces VEGF mRNA expression, both in low and high glucose, but has no significant effect on the VEGF-B mRNA levels.
- the VEGF-C mRNA isolated from hypoxic cells runs slightly faster in gel electrophoresis and an extra band of faster mobility can be seen below the upper mRNA band. This observation suggests that hypoxia affects VEGF-C RNA processing.
- VEGF-C mRNA splicing is altered, affecting the VEGF-C open reading frame and resulting in an alternative VEGF-C protein being produced by hypoxic cells.
- Such alternative forms of VEGF-C and VEGF- C-encoding polynucleotides are contemplated as an aspect ofthe invention.
- This data indicates screening and diagnostic utilities for polynucleotides and polypeptides ofthe invention, such as methods whereby a biological sample is screened for the hypoxia- induced form of VEGF-C and/or VEGF-C mRNA.
- the data further suggests a therapeutic indication for antibodies and/or other inhibitors ofthe hypoxia-induced form of VEGF-C or the normal form of VEGF-C.
- VEGF-C polypeptides Pulse-chase labeling and immunoprecipitation of VEGF-C polypeptides from 293 EBNA cells transfected with VEGF-C expression vector.
- VEGF-C branched amino-terminal peptide designated PAM126
- PAM126 was synthesized as a branched polylysine structure K3PA4 having four peptide acid (PA) chains attached to two available lysine (K) residues.
- the synthesis was performed on a 433A Peptide Synthesizer (Applied Biosystems) using Fmoc-chemistry and TentaGel S MAP RAM 10 resin mix (RAPP Polymere GmbH,
- the PAM126 peptide was dissolved in phosphate buffered saline (PBS), mixed with Freund's adjuvant, and used for immunization of rabbits at bi-weekly intervals using methods standard in the art (Harlow and Lane, Antibodies, a laboratory manual, Cold Spring Harbor Laboratory Press (1988)). Antisera obtained after the fourth booster immunization was used for immunoprecipitation of VEGF-C in pulse-chase experiments, as described below.
- PBS phosphate buffered saline
- 293 EBNA cells transfected with a VEGF-C expression vector i.e., the FLT4-L cDNA inserted into the pREP7 expression vector as described above
- a VEGF-C expression vector i.e., the FLT4-L cDNA inserted into the pREP7 expression vector as described above
- the medium was then changed, and 200 ⁇ Ci of Pro-mixTM (Amersham), was added.
- the cell layers were incubated in this labeling medium for two hours, washed with PBS, and incubated for 0, 15, 30, 60, 90, 120, or 180 minutes in serum-free DMEM (chase).
- VEGF-C polypeptides were analyzed from both the culture medium and from the cell lysates by immunoprecipitation, using the VEGF-C-specific antiserum raised against the NH 2 -terminal peptide (PAM126) ofthe 23 kD VEGF-C form.
- Immunoprecipitated polypeptides were analyzed via SDS-PAGE followed by autoradiography.
- the VEGF-C vector-transfected cells contained a radioactive polypeptide band of about 58kD (originally estimated to be about 55 kD, and re-evaluated to be about 58 kD using different size standards), which was not observed in mock-transfected cells (M). Most of this -58 kD precursor undergoes dimerization. This -58 kD polypeptide band gradually diminished in intensity with increasing chase periods. A 32 kD polypeptide band also is observed in VEGF-C transfected cells (but not mock- transfected cells).
- This 32 kD band disappears from cells with similar kinetics to that of the -58 kD band. Additional analysis indicated that the 32 kD band was a doublet of 29 kD and 31-32 kD forms, held together by disulfide bonds. Simultaneously, increasing amounts of 32 kD and subsequently 23 kD and 14-15 kD polypeptides appeared in the medium.
- the data from the pulse-chase experiments indicate that the -58 kD intracellular polypeptide represents a pro- VEGF-C polypeptide, which is proteolytically cleaved either intracellularly or at the cell surface into the 29 kD and 31-32 kD polypeptides.
- the 29/31 kD form is secreted and simultaneously further processed by proteolysis into the 23 kD and 14-15 kD forms.
- disulfide linked dimers ofthe 29 kD and 15 kD forms were observed.
- processing ofthe VEGF-C precursor occurs as removal of a signal sequence, removal ofthe COOH-terminal domain (BR3P), and removal of an amino terminal polypeptide, resulting in a VEGF-C polypeptide having the TEE... amino terminus.
- the 23 kD polypeptide band appears as a closely-spaced polypeptide doublet, suggesting heterogeneity in cleavage or glycosylation.
- VEGF-C murine VEGF-C
- approximately 1 x 10 6 bacteriophage lambda clones of a commercially-available 12 day mouse embryonal cDNA library (lambda EXlox library, Novagen, catalog number 69632-1) were screened with a radiolabeled fragment of human VEGF-C cDNA containing nucleotides 495 to 1661 of SEQ DD NO: 7.
- One positive clone was isolated.
- a 1323 bp EcoRI/H/wdlll fragment ofthe insert ofthe isolated mouse cDNA clone was subcloned into the corresponding sites ofthe pBluescript SK+ vector (Stratagene) and sequenced.
- the cDNA sequence of this clone was homologous to the human V ⁇ GF-C sequence reported herein, except that about 710 bp of 5 '-end sequence present in the human clone was not present in the mouse clone.
- Hwdlll-TistXI Hr ⁇ dlll site is from the pBluescript SK+ polylinker
- a Hwdlll-TistXI fragment of 881 bp from the coding region of the mouse cDNA clone was radiolabeled and used as a probe to screen two additional mouse cDNA libraries.
- Two additional cDNA clones from an adult mouse heart ZAP II cDNA library (Stratagene, catalog number 936306) were identified.
- Three additional clones also were isolated from a mouse heart 5 '-stretch-plus cDNA library in ⁇ gtl 1 (Clontech Laboratories, Inc., catalog number ML5002b).
- polypeptide corresponding to S ⁇ Q DD NO: 11 is processed into a mature mouse V ⁇ GF-C protein, in a manner analogous to the processing ofthe human V ⁇ GF-C prepropeptide.
- Putative cleavage sites for the mouse protein are identified using procedures outlined above for identification of cleavage sites for the human V ⁇ GF-C polypeptide.
- V ⁇ GF-C The mouse and human V ⁇ GF-C sequences were used to design probes for isolating a quail V ⁇ GF-C cDNA from a quail cDNA library.
- an internal Sphl restriction endonuclease cleavage site was identified about 1.9 kb from the T7 primer side ofthe vector and used for subcloning 5'- and 3'- Sphl fragments, followed by sequencing from the Sphl end ofthe subclones.
- the sequences obtained were identical from both clones and showed a high degree of similarity to the human VEGF-C coding region.
- walking primers were made in both directions and double-stranded sequencing was completed for 1743 base pairs, including the full-length open reading frame.
- the cDNA sequence obtained includes a long open reading frame and 5' untranslated region.
- the DNA and deduced amino acid sequences for the quail cDNA are set forth in SEQ DD NOs: 12 and 13, respectively.
- Studies performed with the putative quail VEGF-C cDNA have shown that its protein product is secreted from transfected cells and interacts with avian VEGFR-3 and VEGFR-2, further confirming the conclusion that the cDNA encodes a quail VEGF-C protein.
- the proteins secreted from 293 -EBNA cells transfected with quail VEGF-C cDNA were analyzed in immunoprecipitation studies using the VEGF-C-specific polyclonal antisera generated against the PAM126 polypeptide (Example 19).
- a doublet band of about 30-32 kD, and a band of about 22-23 kD, were immunoprecipitated from the transfected cells but not from control cells.
- VEGF-C precursor amino acid sequences share a significant degree of conservation. This high degree of homology between species permits the isolation of VEGF-C encoding sequences from other species, especially vertebrate species, and more particularly mammalian and avian species, using polynucleotides ofthe present invention as probes and using standard molecular biological techniques such as those described herein.
- VEGF-C recombinant VEGF-C
- Fig. 6 A lane IP
- the three major, proteolytically-processed forms of VEGF-C migrate in SDS- PAGE as proteins with apparent molecular masses of 32/29 kD (doublet), 21 kD and 15 kD.
- Two minor polypeptides exhibit approximate molecular masses of 63 and 52 kD, respectively.
- One of these polypeptides is presumably a glycosylated and non-processed form; the other polypeptide is presumably glycosylated and partially processed.
- More precise size measurements revealed that the molecular masses ofthe VEGF-C forms that were initially estimated as 63, 52, 32, 23, and 14 kD (using SDS-PAGE under reducing conditions and a different set of size standards) are approximately 58, 43, 31, 29, 21, and 15 kD, respectfully (the initial measurements in most cases falling within acceptable 10% error ofthe more precise measurements).
- an immunoaffinity column was used to purify VEGF-C polypeptides from the conditioned medium of 293 EBNA cells transfected with VEGF-C cDNA.
- a rabbit was immunized with a synthetic peptide corresponding to amino acids 104-120 of SEQ DD NO: 8: H 2 N-EETn FAAAHYNTEILK (see PAM126 in Example 19).
- the IgG fraction was isolated from the serum ofthe immunized rabbit using protein A Sepharose (Pharmacia).
- the isolated IgG fraction was covalently bound to CNBr-activated Sepharose CL-4B (Pharmacia) using standard techniques at a concentration of 5 mg IgG/ml of Sepharose.
- This immunoaffinity matrix was used to isolate processed VEGF-C from 1.2 liters ofthe conditioned medium (CM).
- the purified material eluted from the column was analyzed by gel electrophoresis and Western blotting. Fractions containing VEGF-C polypeptides were combined, dialyzed against 10 mM Tris HC1, vacuum-dried, electrotransferred to
- Immobilon-P polyvinylidene difluoride or PVDF
- transfer membrane Mipore, Marlborough, MA
- the polypeptide band of 32 kD yielded two distinct sequences: NH 2 - FESGLDLSDA... and NH 2 -AVVMTQTPAS... (SEQ DD NO: 14), the former corresponding to the N-terminal part of VEGF-C after cleavage ofthe signal peptide, starting from amino acid 32 (SEQ DD NO: 8), and the latter corresponding to the kappa- chain of IgG, which was present in the purified material due to "leakage" ofthe affinity matrix during the elution procedure.
- a construct (VEGF-C NHis) encoding a VEGF-C mutant was generated.
- the construct encoded a VEGF-C mutant that fused a 6xHis tag to the N- terminus ofthe secreted precursor (i.e., between amino acids 31 and 33 in SEQ DD NO: 8).
- the phenylalanine at position 32 was removed to prevent possible cleavage ofthe tag sequence during secretion of VEGF-C.
- the VEGF-C NHis construct was cloned into pREP7 as a vector; the construction is described more fully in Example 28, below.
- the calcium phosphate co-precipitation technique was used to transfect VEGF-C NHis into 293 EBNA cells.
- Cells were incubated in DMEM/ 10% fetal calf serum in 15 cm cell culture dishes (a total of 25 plates). The following day, the cells were reseeded into fresh culture dishes (75 plates) containing the same medium and incubated for 48 hours. Cell layers were then washed once with PBS and DMEM medium lacking FCS was added. Cells were incubated in this medium for 48 hours and the medium was collected, cleared by centrifiigation at 5000 x g and concentrated 500X using an Ultrasette Tangential Flow Device (Filtron, Northborough, MA), as described in Example 5 above.
- Ultrasette Tangential Flow Device Frtron, Northborough, MA
- VEGF-C NHis was purified from the concentrated conditioned medium using TALONTM Metal Affinity Resin (Clontech Laboratories, Inc.) and the manufacturer's protocol for native protein purification using imidazole-containing buffers. The protein was eluted with a solution containing 20 mM Tris-HCl (pH 8.0), 100 mM NaCl, and 200 mM imidazole. The eluted fractions containing purified VEGF-C NHis were detected by immunoblotting with Antiserum 882 (antiserum from rabbit 882, immunized with the PAM-126 polypeptide). Fractions containing VEGF-C NHis were combined, dialyzed and vacuum- dried.
- TALONTM Metal Affinity Resin Clontech Laboratories, Inc.
- the polypeptide band of 21 kD yielded the sequence H 2 N-AHYNTEILKS . . ., corresponding to an amino-terminus starting at amino acid 112 of SEQ DD NO: 8.
- the proteolytic processing site which results in the 21 kD form of VEGF-C produced by transfected 293 EBNA cells apparently occurs nine amino acid residues downstream ofthe cleavage site which results in the 23 kD form of VEGF-C secreted by PC-3 cells.
- the N-terminus ofthe 15 kD form was identical to the N-terminus ofthe 32 kD form (NH 2 -FESGLDLSDA..).
- the 15 kD form was not detected when 5 recombinant VEGF-C was produced by COS cells. This suggests that production of this form is cell lineage specific.
- VEGF-C dimers The composition of VEGF-C dimers was analyzed as follows. Cells (293
- VEGF-C mutant designated "R102S”
- R102S a VEGF-C mutant
- VEGF-C-R102S-encoding DNA in a pREP7 vector, was transfected into 293 EBNA cells and expressed as described above.
- VEGF-C polypeptides were immunoprecipitated using antisera 882 (obtained by immunization of a rabbit with a polypeptide corresponding to residues 104-120 of SEQ ED NO: 8 (see previous Example)) and antisera 905 (obtained by immunization of a rabbit
- each high molecular weight form of VEGF-C (Fig. 6B, bands 1-4) consists of at least two monomers bound by disulfide bonds
- bands 1-3 are the doublet of 32/29 kD, where both proteins are present in an equimolar ratio.
- the main fraction ofthe 21 kD form is secreted as either a monomer or as a homodimer connected by means other than disulfide bonds (bands 6 and lanes 6 in Figs. 6A-C).
- the R102S mutation creates an additional site for N-linked glycosylation in VEGF-C at the asparagine residue at position 100 in SEQ DD NO: 8. Glycosylation at this additional glycosylation site increases the apparent molecular weight of polypeptides containing the site, as confirmed in Figures 6A-C and Figures 7A-B. The additional glycosylation lowers the mobility of forms of VEGF-C-R102S that contain the additional glycosylation site, when compared to polypeptides of similar primary structure corresponding to VEGF-C.
- Figures 6A-C and Figures 7A-B reveal that the VEGF-C- R102S polypeptides corresponding to the 32 kD and 15 kD forms of wt VEGF-C exhibit increased apparent molecular weights, indicating that each of these polypeptides contains the newly introduced glycosylation site.
- the VEGF-C-R102S polypeptide corresponding to the 15 kD polypeptide from VEGF-C comigrates on a gel with the 21 kD form ofthe wild type (wt) VEGF-C, reflecting a shift on the gel to a position corresponding to a greater apparent molecular weight. (Compare lanes 4 in Figures 6A and 6C).
- VEGF-C The mobility ofthe 58 kD form of VEGF-C was slowed to 64 kD by the R102S mutation, indicating that this form contains the appropriate N-terminal peptide of VEGF- C.
- the mobilities ofthe 21, 29, and 43 kD forms were unaffected by the R102S mutation, suggesting that these polypeptides contain peptide sequences located C-terminally of R 102 .
- another VEGF-C mutant designated "R226,227S” was prepared and analyzed. To prepare a DNA encoding VEGF-C-R226,227S, the arginine codons at positions 226 and 227 of SEQ DD NO: 8 were replaced with serine codons by site-directed mutagenesis.
- VEGF-C is a heterodimer consisting of (1) a polypeptide of 32 kD containing amino acids 32-227 ofthe prepro- VEGF-C (amino acids 32 to 227 in SEQ DD NO: 8) attached by disulfide bonds to (2) a polypeptide of 29 kD beginning with amino acid 228 in SEQ DD NO: 8.
- both antisera 882 and 905 recognized some or all ofthe three major processed forms of VEGF-C (32/29 kD, 21 kD and 15 kD).
- the conditioned medium was reduced by incubation in the presence of 10 mM dithiothreitol for two hours at room temperature with subsequent alkylation by additional incubation with 25 mM iodoacetamide for 20 minutes at room temperature, neither antibody precipitated the 29 kD component, although antibody 882 still recognized polypeptides of 32 kD, 21 kD and 15 kD. In subsequent experiments it was observed that neither antibody was capable of immunoprecipitating the 43 kD form.
- antisera 905 recognized only the 32 kD and 15 kD polypeptides, which include sequence ofthe oligopeptide (amino acids 33 to 54 of SEQ DD NO: 8) used for immunization to obtain antisera 905. Taking into account the mobility shift ofthe 32 kD and 15 kD forms, the immunoprecipitation results with the R102S mutant were similar (Figs. 8A-B).
- the specificity of antibody 905 is confirmed by the fact that it did not recognize a VEGF-C ⁇ N form wherein the N-terminal propeptide spanning residues 32-102 ofthe unprocessed polypeptide had been deleted (Fig. 8B).
- the results of these experiments also demonstrate that the 21 kD polypeptide is found (1) in heterodimers with other molecular forms (see Figs. 6A-C and Figs. 7A-B), and (2) secreted as a monomer or a homodimer held by bonds other than disulfide bonds (Figs. 6A and 6B, lanes 6).
- VEGF-C vascular endothelial growth factor-C
- a variety of VEGF-C monomers were observed and these monomers can vary depending on the level and pattern of glycosylation.
- VEGF-C was observed as a multimer, for example a homodimer or a heterodimer.
- the processing of VEGF-C is schematically presented in Fig. 9 (disulfide bonds not shown). All forms of VEGF-C are within the scope ofthe present invention.
- Example 23 In situ Hybridization of Mouse Embryos
- VEGF-C mRNA distribution in different cells and tissues sections of 12.5 and 14.5-day post-coitus (p.c.) mouse embryos were prepared and analyzed via in situ hybridization using labeled VEGF-C probes. In situ hybridization of tissue sections was performed as described in Vastrik et al, J. Cell Biol, 725:1197-1208 (1995).
- a mouse VEGF-C antisense RNA probe was generated from linearized pBluescript II SK+ plasmid (Stratagene Inc., La Jolla, CA), containing a cDNA fragment corresponding to nucleotides 499-979 of a mouse VEGF-C cDNA (SEQ DD NO: 10). Radiolabeled RNA was synthesized using T7 polymerase and [ 35 S]-UTP (Amersham). Mouse VEGF-B antisense and sense RNA probes were synthesized in a similar manner from linearized pCRII plasmid containing the mouse VEGF-B cDNA insert as described Olofsson et al, Proc. Natl Acad. Sci.
- VEGF-C mRNA was particularly prominent in the mesenchyme around the vessels surrounding the developing metanephros.
- hybridization signals were observed between the developing vertebrae, in the developing lung mesenchyme, in the neck region and developing forehead. The specificity of these signals was evident from the comparison with VEGF-B expression in an adjacent section, where the myocardium gave a very strong signal and lower levels of VEGF-B mRNA were detected in several other tissues. Both genes appear to be expressed in between the developing vertebrae, in the developing lung, and forehead. Hybridization ofthe VEGF-C sense probe showed no specific expression within these structures.
- VEGF-C is positive for VEGF-C mRNA, with particularly high expression in connective tissue surrounding certain vessels.
- the adjacent mesenterial VEGFR-3 signals that were observed originate from small capillaries ofthe mesenterium. Therefore, there appears to be a paracrine relationship between the production ofthe mRNAs for VEGF-C and its receptor.
- This data indicates that VEGF-C is expressed in a variety of tissues. Moreover, the pattern of expression is consistent with a role for VEGF-C in venous and lymphatic vessel development. Further, the data reveals that VEGF-C is expressed in non-human animals.
- RNAs from brain, lung, liver and kidney was hybridized with a pool ofthe following probes: a human full-length VEGF-C cDNA insert (Genbank Ace. No. X94216), a human VEGF-B 167 cDNA fragment (nucleotides 1-382, Genbank Ace. No. U48800) obtained by PCR amplification; and a human VEGF 581 bp cDNA fragment covering base pairs 57-638 (Genbank Ace. No. XI 5997). Blots were washed under stringent conditions, using techniques standard in the art.
- Mouse embryo multiple tissue Northern blot (Clontech Inc.) containing 2 g of polyadenylated RNAs from 7, 11, 15 and 17 day postcoital (p.c.) embryos was hybridized with mouse VEGF-C cDNA fragment (base pairs 499-656).
- a mouse adult tissue Northern blot was hybridized with the probes for human VEGF, VEGF-B 167 , VEGF-C and with a VEGFR-3 cDNA fragment (nucleotides 1-595; Genbank Ace. No. X68203).
- VEGFR-3 expression showed that the tissues where VEGF-C is expressed also contain mRNA for its cognate receptor tyrosine kinase, although in the adult liver VEGFR-3 mRNA was disproportionally abundant.
- polyadenylated RNA isolated from mouse embryos of various gestational ages (7, 11, 15, and 17 day p.c.) was hybridized with the mouse VEGF-C probe.
- mRNAs for VEGF family members by serum, interleukin-1 and dexamethasone in human fibroblasts in culture
- Human IMR-90 fibroblasts were grown in DMEM medium containing 10% FCS and antibiotics. The cells were grown to 80% confluence, then starved for 48 hours in 0.5 % FCS in DMEM. Thereafter, the growth medium was changed to DMEM containing 5% FCS, with or without 10 ng/ml interleukin-1 (EL-1) and with or without 1 mM dexamethasone. The culture plates were incubated with these additions for the times indicated, and total cellular RNA was isolated using the TRIZOL kit (GD3CO-BRL). About 20 ⁇ g of total RNA from each sample was electrophoresed in 1.5% formaldehyde- agarose gels as described in Sambrook et al, supra (1989).
- the gel was used for Northern blotting and hybridization with radiolabeled insert DNA from the human VEGF clone (a 581 bp cDNA covering bps 57-638, Genbank Ace. No. 15997) and a human VEGF-B 167 cDNA fragment (nucleotides 1-382, Genbank Ace. No. U48800). Subsequently, the Northern blots were probed with radiolabeled insert from the VEGF-C cDNA plasmid. Primers were labeled using a standard technique involving enzymatic extension reactions of random primers, as would be understood by one of ordinary skill in the art.
- the Northern blot analyses revealed that very low levels of VEGF-C and VEGF are expressed by the starved EVtR-90 cells as well as cells after 1 hour of stimulation. In contrast, abundant VEGF-B mRNA signal was visible under these conditions. After 4 hours of serum stimulation, there was a strong induction of VEGF-C and VEGF mRNAs, which were further increased in the EL-1 treated sample. The effect of 1L-1 seemed to be abolished in the presence of dexamethasone. A similar pattern of enhancement was observed in the 8 hour sample, but a gradual down-regulation of all signals was observed for both RNAs in the 24 hour and 48 hour samples. In contrast, VEGF-B mRNA levels remained constant and thus showed remarkable stability throughout the time period. The results are useful in guiding efforts to use VEGF-C and its fragments, its antagonists, and anti- VEGF-C antibodies in methods for treating a variety of disorders.
- mouse VEGF-C cDNA was expressed as a recombinant protein and the secreted protein was analyzed for its receptor binding properties.
- the binding of mouse VEGF-C to the human VEGFR-3 extracellular domain was studied by using media from Bosc23 cells transfected with mouse VEGF-C cDNA in a retroviral expression vector.
- the 1.8 kb mouse VEGF-C cDNA was cloned as an EcoRI fragment into the retroviral expression vector pBabe-puro containing the SV40 early promoter region [Morgenstern et al, Nucl. Acids Res., 75:3587-3595 (1990)], and transfected into the Bosc23 packaging cell line [Pearet et al, Proc. Natl Acad. Sci. (USA), 90:8392-8396
- Bosc23 cells also were transfected with the previously-described human VEGF-C construct in the pREP7 expression vector.
- the transfected cells were cultured for 48 hours prior to metabolic labeling.
- Cells were changed into DMEM medium devoid of cysteine and methionine, and, after 45 minutes of preincubation and medium change, Pro-mixTM L-[ 35 S] in vitro cell labeling mix (Amersham Corp.), in the same medium, was added to a final concentration of about 120 ⁇ CL ml. After 6 hours of incubation, the culture medium was collected and clarified by centrifiigation.
- VEGF-C Immunoprecipitation of VEGF-C from media of transfected and metabolically-labeled cells revealed bands of approximately 30-32xl0 3 M, (a doublet) and 22-23xl0 3 M_ in 12.5% SDS-PAGE. These bands were not detected in samples from nontransfected or mock-transfected cells. These results show that antibodies raised against human VEGF-C recognize the corresponding mouse ligand, and provide an indication that the proteolytic processing that occurs to produce murine VEGF-C is analogous to the processing that occurs to produce human VEGF-C.
- mouse VEGF-C binds to human VEGFR-3.
- the slightly faster mobility ofthe mouse VEGF-C polypeptides that was observed may be caused by the four amino acid residue difference observed in sequence analysis (residues H88-E91, Fig. 10).
- VEGFR-3 receptor stimulation experiments subconfluent NEH 3T3-FH4 cells, Pajusola et al, Oncogene, 9:3545-3555 (1994), were starved overnight in serum-free medium containing 0.2% BSA. In general, the cells were stimulated with the conditioned medium from VEGF-C vector-transfected cells for 5 minutes, washed three times with cold PBS containing 200 ⁇ M vanadate, and lysed in PJPA buffer for immunoprecipitation analysis.
- the lysates were centrifuged for 25 minutes at 16000 x g and the resulting supernatants were incubated for 2 hours on ice with the specific antisera, followed by immunoprecipitation using protein A-sepharose and analysis in 7% SDS-PAGE. Polypeptides were transferred to nitrocellulose and analyzed by immunoblotting using anti-phosphotyrosine (Transduction Laboratories) and anti- receptor antibodies, as described by Pajusola et al, Oncogene, 9:3545-3555 (1994). Filter stripping was carried out at 50°C for 30 minutes in 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7, with occasional agitation.
- Mouse VEGF-C appeared to be a potent inducer of VEGFR-3 autophosphorylation, with the 195xl0 3 M, precursor and proteolytically-cleaved 125 x 10 3 M, tyrosine kinase polypeptides ofthe receptor (Pajusola et al, Oncogene, 9:3545-3555 (1994)), being phosphorylated.
- VEGFR-2 stimulation was studied in subconfluent porcine aortic endothelial (PAE) cells expressing KDR (VEGFR-2) (PAE-VEGFR-2) [Waltenberger et al, J.
- VEGFR-2 [Waltenberger et al, J. Biol. Chem., 269:26988-26995 (1994)] was used. The immunoprecipitates were analyzed as described for VEGFR-3 in 7% SDS-PAGE followed by Western blotting with anti-phosphotyrosine antibodies, stripping ofthe filter, and re- probing it with anti-VEGFR-2 antibodies (Santa Cruz). VEGFR-2 stimulation was first tried with unconcentrated medium from cells expressing recombinant VEGF-C, but immunoblotting analysis did not reveal any receptor autophosphorylation.
- VEGF-C can also induce VEGFR-2 autophosphorylation as observed for human VEGF-C
- PAE cells expressing VEGFR-2 were stimulated with tenfold concentrated medium from cultures transfected with mouse VEGF-C expression vector and autophosphorylation was analyzed.
- cells treated with tenfold concentrated medium containing human recombinant VEGF-C Joukov et al, (1996)), unconcentrated medium from human VEGF-C baculovirus infected insect cells, or pervanadate (a tyrosyl phosphatase inhibitor) were used.
- VEGFR-2 In response to human baculoviral VEGF-C as well as pervanadate treatment, VEGFR-2 was prominently phosphorylated, whereas human and mouse recombinant VEGF-C gave a weak and barely detectable enhancement of autophosphorylation, respectively. Media from cell cultures transfected with empty vector or VEGF-C cloned in the antisense orientation did not induce autophosphorylation of VEGFR-2. Therefore, mouse VEGF-C binds to VEGFR-3 and activates this receptor at a much lower concentration than needed for the activation of VEGFR-2. Nevertheless, the invention comprehends methods for using the materials ofthe invention to take advantage ofthe interaction of VEGF-C with VEGFR-2, in addition to the interaction between VEGF-C and VEGFR-3.
- VEGF-C E104-S213 fragment expressed in Pichia yeast stimulates autophosphorylation of Flt4 (VEGFR-3) and KDR (VEGFR-2)
- a truncated form of human VEGF-C cDNA was constructed wherein (1) the sequence encoding residues of a putative mature VEGF-C amino terminus H 2 N- E(104)ETIK (SEQ DD NO: 8, residues 104 et seq.) was fused in-frame to the yeast PHO1 signal sequence (Invitrogen Pichia Expression Kit, Catalog #K1710-01), and (2) a stop codon was introduced after amino acid 213 (H 2 N- ...RCMS; i.e., after codon 213 of SEQ DD NO: 7).
- the resultant truncated cDNA construct was then inserted into the Pichia pastoris expression vector pHEL-Sl (Invitrogen).
- pHEL-Sl Pichia pastoris expression vector
- an internal Bglll site in the VEGF-C coding sequence was mutated without change ofthe encoded polypeptide sequence.
- This VEGF-C expression vector was then transfected into Pichia cells and positive clones were identified by screening for the expression of VEGF-C protein in the culture medium by Western blotting.
- One positive clone was grown in a 50 ml culture, and induced with methanol for various periods of time from 0 to 60 hours. About 10 ⁇ l of medium was analyzed by gel electrophoresis, followed by Western blotting and detection with anti- VEGF-C antiserum, as described above.
- the medium containing the recombinant VEGF-C protein was concentrated by Centricon 30 kD cutoff ultrafiltration and used to stimulate NIH 3T3 cells expressing Flt4 (VEGFR-3) and porcine aortic endothelial (PAE) cells expressing KDR (VEGFR-2).
- the stimulated cells were lysed and immunoprecipitated using VEGFR-specific antisera and the immunoprecipitates were analyzed by Western blotting using anti-phosphotyrosine antibodies, chemiluminescence, and fluorography.
- vanadate (VO 4 ) treatment ofthe cells for 10 minutes was used.
- VEGF-homologous domain of VEGF-C consisting of amino acid residues 104E - 213S (SEQ DD NO: 8, residues 104-213) can be recombinantly produced in yeast and is capable of stimulating the autophosphorylation of Flt4 (VEGFR-3) and KDR (VEGFR-2).
- Recombinant VEGF-C fragments such as the fragment described herein, which are capable of stimulating Flt4 or KDR autophosphorylation are intended as aspects ofthe invention; methods of using these fragments are also within the scope ofthe invention.
- Example 28 Properties of the differentially processed forms of VEGF-C
- oligonucleotides were used to generate a set of VEGF-C variants and analogs: 5 5'- TCTCTTCTGTGCTTGAGTTGAG -3' (SEQ DD NO: 15), used to generate
- VEGF-C R102S arginine mutated to serine at position 102 (SEQ DD NO: 8)
- VEGF-C NHis 5'-GGGCTCCGCGTCCGAGAGGTCGAGTCCGGACTCGTGATGGT GATGGTGATGGGCGGCGGCGGCGGCGGGCGCCTCGCGAGGACC -3' (SEQ DD NO: 19), used to generate VEGF-C NHis (this construct encodes a polypeptide with a 6xHis tag fused to approximately the N-terminus ofthe secreted precursor, as described in 20 Example 21 (amino acid 33 of SEQ DD NO: 8)).
- VEGF-C mutant constructs were further modified to obtain additional constructs.
- VEGF-C R102G in pALTER (Promega) and oligonucleotide 5'-GTATTATAATGTCCTCCACCAAATTTTATAG -3' (SEQ DD NO: 20) were used to generate VEGF-C 4G, which encodes a polypeptide with four point 25 mutations: R102G, Al 10G, Al 11G, and Al 12G (alanines mutated to glycines at positions 1 10-112 (SEQ DD NO: 8). These four mutations are adjacent to predicted sites of cleavage of VEGF-C expressed in PC-3 and recombinantly expressed in 293 EBNA cells.
- GGCCGCTAGTGATGGTGATGGTGATGAATAATGGAATGAACTTGTCTGTAAAC ATCCAG -3' (SEQ DD NO: 21) to generate VEGF-C ⁇ N ⁇ CHis.
- This construct encodes a polypeptide with a deleted N-terminal propeptide (amino acids 32-102); a deleted C- terminal propeptide (amino acids 226-419 of SEQ DD NO: 8); and an added 6xHis tag at the C-terminus (see SEQ DD NO: 59).
- the conditioned media from the transfected and starved cells were concentrated 5-fold and used to assess their ability to stimulate tyrosine phosphorylation of Flt4 (VEGFR-3) expressed in ⁇ IH 3T3 cells and KDR (VEGFR-2) expressed in PAE cells.
- Wild type (wt) VEGF-C, as well as all three mutant polypeptides stimulated tyrosine phosphorylation of VEGFR-3. The most prominent stimulation observed was by the short mature VEGF-C ⁇ CHis. This mutant, as well as VEGF-C ⁇ His, also stimulated tyrosine phosphorylation of VEGFR-2.
- VEGF-C vascular endothelial growth factor-C
- the active part of VEGF-C responsible for its binding to VEGFR-3 and VEGFR-2 is localized between amino acids 102 and 226 (SEQ DD NO: 8) ofthe VEGF-C precursor.
- SEQ DD NO: 8 amino acids 102 and 226
- Analysis and comparison of binding properties and biological activities of these VEGF-C proteins and mutants, using assays such as those described herein, will provide data concerning the significance ofthe observed major 32/29 kD and 21-23 kD VEGF-C processed forms.
- the data indicate that constructs encoding amino acid residues 103-225 ofthe VEGF-C precursor (SEQ DD NO: 8) generate a recombinant ligand that is functional for both VEGFR-3 and VEGFR-2.
- VEGF-C polypeptide retain biological activity.
- Example 27 demonstrates that a fragment with residues 104-213 of SEQ DD NO:
- Example 21 data from Example 21 demonstrates that a VEGF-C polypeptide having its amino terminus at position 112 of SEQ DD NO: 8 retains activity. Additional experiments have shown that a fragment lacking residues 1-112 of SEQ DD
- a polypeptide which retains the conserved motif RCXXCC e.g., a polypeptide comprising from about residue 161 to about residue 211 of SEQ DD NO: 8 is postulated to retain VEGF-C biological activity. To maintain native conformation of these fragments, it may be preferred to retain about 1-2 additional amino acids at the carboxy-terminus and 1-
- the materials and methods ofthe invention include all VEGF-C fragments, variants, and analogs that retain at least one biological activity of VEGF-C, regardless ofthe presence or absence of members ofthe conserved set of cysteine residues.
- VEGF-C growth factor stimulates the Flt4 receptor, showing less activity towards the KDR receptor of blood vessels (Joukov et al, EMBO J.,
- the human K14 keratin promoter is active in the basal cells of stratified squamous epithelia (Vassar et al, Proc. Natl. Acad. Sci. (USA), 56:1563-1567 (1989)) and was used as the expression control element in the recombinant VEGF-C transgene.
- the vector containing the K14 keratin promoter is described in Vassar et al, Genes Dev., 5:714-727 (1991) and Nelson et al, J. Cell Biol. 97:244-251 (1983).
- the recombinant VEGF-C transgene was constructed using the human full length VEGF-C cDNA (GenBank Ace. No. X94216). This sequence was excised from a pCI-neo vector (Promega) with XhoVNotl, and the resulting 2027 base pair fragment containing the open reading frame and stop codon (nucleotides 352-1611 of SEQ ED NO: 7) was isolated. The isolated fragment was then subjected to an end-filling reaction using the Klenow fragment of DNA polymerase. The blunt-ended fragment was then ligated to a similarly opened BamHJ restriction site in the K14 vector.
- the resulting construct contained the EcoRI site derived from the polylinker ofthe pCI-neo vector. This EcoRI site was removed using standard techniques (a Klenow-mediated fill-in reaction following partial digestion ofthe recombinant intermediate with EcoRI) to facilitate the subsequent excision ofthe DNA fragment to be injected into fertilized mouse oocytes.
- the resulting clone, designated K 14- V ⁇ GF-C, is illustrated in Fig. 20 of commonly-owned PCT patent application PCT/FI96/00427, filed August 01, 1996, published as WO 97/05250.
- the EcoRI-Hwdlll fragment from clone K 14 V ⁇ GF-C containing the K 14 promoter, V ⁇ GF-C cDNA, and K14 polyadenylation signal was isolated and injected into fertilized oocytes ofthe FVB-MH mouse strain.
- the injected zygotes were transplanted to oviducts of pseudopregnant C57BL/6 x DBA/2J hybrid mice.
- the resulting founder mice were analyzed for the presence ofthe transgene by polymerase chain reaction of tail DNA using the primers: 5'-CATGTACGAACCGCCAG-3' (SEQ ED NO: 22) and 5'- AATGACCAGAGAGAGGCGAG-3' (SEQ DD NO: 23).
- tail DNAs were subjected to EcoRV digestion and subsequent Southern analysis using the EcoRI-Ht «dIII fragment injected into the mice.
- 2 were positive, having approximately 40-50 copies and 4-6 copies ofthe transgene in their respective genomes.
- the mouse with the high copy number transgene was small, developed more slowly than its litter mates and had difficulty eating (i.e., suckling). Further examination showed a swollen, red snout and poor fur. Although fed with a special liquid diet, it suffered from edema ofthe upper respiratory and digestive tracts after feeding and had breathing difficulties. This mouse died eight weeks after birth and was immediately processed for histology, immunohistochemistry, and in situ hybridization. Histological examination showed that in comparison to the skin of littermates, the dorsal dermis of K 14- V ⁇ GF-C transgenic mice was atrophic and connective tissue was replaced by large lacunae devoid of red cells, but lined with a thin endothelial layer.
- V ⁇ GF-C overexpression in the basal epidermis is capable of promoting the growth of extensive vessel structure in the underlying skin, including large vessel lacunae.
- the endothelial cells surrounding these lacunae contained abundant Flt4 mRNA in in situ hybridization (see Examples 23 and 30 for methodology).
- the vessel morphology indicates that VEGF-C stimulates the growth of vessels having features of lymphatic vessels.
- the other K14- VEGF-C transgenic mouse had a similar skin histopathology.
- the dermis was atrophic (45% of the dermal thickness, compared to 65% in littermate controls) and its connective tissue was replaced by large dilated vessels devoid of red cells, but lined with a thin endothelial cell layer. Such abnormal vessels were confined to the dermis and resembled the dysfunctional, dilated spaces characteristic of hyperplastic lymphatic vessels. See Fossum, et al, J. Vet. Int. Med, 6: 283-293 (1992). Also, the ultrastructural features were reminiscent of lymphatic vessels, which differ from blood vessels by having overlapping endothelial junctions, anchoring filaments in the vessel wall, and a discontinuous or even partially absent basement membrane. See Leak, Microvasc. Res., 2: 361-391 (1970).
- lymphatic endothelium has a great capacity to distend in order to adapt to its functional demands.
- in vitro proliferation assays were conducted. Specifically, to measure DNA synthesis, 3mm x 3mm skin biopsies from four transgenic and four control mice were incubated in D-MEM with 10 micrograms/ml BrdU for 6 hours at 37°C, fixed in 70% ethanol for 12 hours, and embedded in paraffin. After a 30 minute treatment with 0.
- VEGF- C-receptor interaction was performed using mouse monoclonal anti-BrdU antibodies (Amersham). It appeared that the VEGF- C-receptor interaction in the transgenic mice transduced a mitogenic signal, because, in contrast to littermate controls, the lymphatic endothelium ofthe skin from young K14- VEGF-C mice showed increased DNA synthesis as demonstrated by BrdU incorporation followed by staining with anti-BrdU antibodies. This data further confirms that VEGF-C acts as a true growth factor in mammalian tissues.
- VEGF transgene did not induce lymphatic proliferation, but caused enhanced density of hyperpermeable, tortuous blood microvessels instead.
- Angiogenesis is a multistep process which includes endothelial proliferation, sprouting, and migration. See Folkman et al, J. Biol Chem., 267: 10931- 10934 (1992). To estimate the contribution of such processes to the transgenic phenotype, the morphology and function ofthe lymphatic vessels was analysed using fluorescent microlymphography using techniques known in the art. See Leu et al, Am. J. Physiol, 267: 1507-1513 (1994); and Swartz et al, Am. J. Physiol, 270: 324-329 (1996). Briefly, eight-week old mice were anesthetized and placed on a heating pad to maintain a 37°C temperature.
- the solution was infused with a constant pressure of 50 cm water (averaging roughly 0.01 microliters per minute flow rate) until the extent of network filling remained constant (approximately 2 hours).
- Flow rate and fluorescence intensity were monitorerd continuously throughout the experiment.
- a typical honeycomb-like network with similar mesh sizes was observed in both control and transgenic mice, but the diameter of lymphatic vessels was about twice as large in the transgenic mice, as summarized in the table below.
- the intravital fluorescence microscopy of blood vessels was performed as has been described in the art. See Fukumura et al, Cancer Res., 55: 4824-4829 (1995).
- VEGF-C is also capable of binding to and activating VEGFR-2, which is the major mitogenic receptor of blood vessel endothelial cells.
- VEGFR-2 which is the major mitogenic receptor of blood vessel endothelial cells.
- high concentrations of VEGF-C stimulate the growth and migration of bovine capillary endothelial cells which express VEGFR-2, but not significant amounts of VEGFR-3.
- VEGF-C induces vascular permeability in the Miles assay [Miles, A. A, and Miles, E. M., J. Physiol, 775:228-257 (1952); and Udaka, et al., Proc. Soc. Exp. Biol.
- VEGF- C is less potent than VEGF in the Miles assay, 4- to 5-fold higher concentrations of VEGF-C ⁇ N ⁇ CHis being required to induce the same degree of permeability.
- the specific effects of VEGF-C on lymphatic endothelial cells may reflect a requirement for the formation of VEGFR-3xVEGFR-2 heterodimers for endothelial cell proliferation at physiological concentrations ofthe growth factor. Such possible heterodimers may help to explain how three homologous VEGFs exert partially redundant, yet strikingly specific biological effects.
- VEGF-C polypeptides and polypeptide variants and analogs having VEGF-C biological activity e.g., anti- VEGF-C antibodies and VEGF-C antagonists that inhibit VEGF-C activity (e.g., by binding VEGF-C or interfering with VEGF-C/receptor interactions.
- the data indicates a therapeutic utility for VEGF-C polypeptides in patients wherein growth of lymphatic tissue may be desirable (e.g., in patients following breast cancer or other surgery where lymphatic tissue has been removed and where lymphatic drainage has therefore been compromised, resulting in swelling; or in patients suffering from elephantiasis).
- the data indicates a therapeutic utility for anti- VEGF-C antibody substances and VEGF-C antagonists for conditions wherein growth-inhibition of lymphatic tissue may be desirable (e.g., treatment of lymphangiomas). Accordingly, methods of administering VEGF-C and VEGF-C variants, analogs, and antagonists are contemplated as methods and materials of the invention.
- Example 30 Expression of VEGF-C and FIt4 in the Developing Mouse Embryos from a 16-day post-coitus pregnant mouse were prepared and fixed in 4% paraformaldehyde (PFA), embedded in paraffin, and sectioned at 6 ⁇ m.
- the sections were placed on silanated microscope slides and treated with xylene, rehydrated, fixed for 20 minutes in 4% PFA, treated with proteinase K (7mg/ml; Merck, Darmstadt, Germany) for 5 minutes at room temperature, again fixed in 4% PFA and treated with acetic anhydride, dehydrated in solutions with increasing ethanol concentrations, dried and used for in situ hybridization.
- In situ hybridization of sections was performed as described (Vastrik et al, J.
- a mouse VEGF-C antisense RNA probe was generated from linearized pBluescript II SK+ plasmid (Stratagene Inc.), containing a fragment corresponding to nucleotides 499-979 of mouse VEGF-C cDNA, where the 5 noncoding region and the BR3P repeat were removed by Exonuclease III treatment. The fragment had been cloned into the EcoRI and H dIII sites of pBluescript II SK+. Radiolabeled RNA was synthesized using T7 RNA Polymerase and [ 35 S]-UTP (Amersham, Little Chalfont, UK). About two million cpm ofthe V ⁇ GF-C probe was applied per slide. After an overnight hybridization, the slides were washed first in 2x SSC and 20-30 mM
- Flt4-hybridizing structures appeared to correspond to the developing lymphatic and venous endothelium.
- a plexus-like endothelial vascular structure surrounding the developing nasopharyngeal mucous membrane was observed.
- V ⁇ GF-C The most prominent signal using the V ⁇ GF-C probe was obtained from the posterior part ofthe developing nasal conchae, which in higher magnification showed the epithelium surrounding loose connective tissue/forming cartilage. This structure gave a strong in situ hybridization signal for VEGF-C. With the VEGF-C probe, more weakly hybridizing areas were observed around the snout, although this signal is much more homogeneous in appearance. Thus, the expression of VEGF-C is strikingly high in the developing nasal conchae. The conchae are surrounded with a rich vascular plexus, important in nasal physiology as a source for the mucus produced by the epithelial cells and for warming inhaled air.
- VEGF-C is important in the formation ofthe concheal venous plexus at the mucous membranes, and that it may also regulate the permeability of the vessels needed for the secretion of nasal mucus.
- VEGF-C and its derivatives, and antagonists could be used in the regulation ofthe turgor ofthe conchal tissue and mucous membranes and therefore the diameter ofthe upper respiratory tract, as well as the quantity and quality of mucus produced.
- the invention contemplates the use ofthe materials ofthe invention, including VEGF-C, Flt4, and their derivatives, in methods of diagnosing and treating inflammatory and infectious conditions affecting the upper respiratory tract, including nasal structures.
- VEGF-C gene were isolated from a human genomic DNA library using VEGF-C cDNA fragments as probes.
- a human genomic library in bacteriophage EMBL-3 lambda (Clontech) was screened using a PCR-generated fragment corresponding to nucleotides 629-746 ofthe human VEGF-C cDNA (SEQ ID NO: 7).
- One positive clone, designated "lambda 3” was identified, and the insert was subcloned as a 14 kb Xhol fragment into the pBluescript II (pBSK II) vector (Stratagene).
- the genomic library also was screened with a labeled 130 bp Notl-Sacl fragment from the 5'-noncoding region of the VEGF-C cDNA (the NotI site is in the polylinker ofthe cloning vector; the S ⁇ cl site corresponds to nucleotides 92-97 of SEQ DD NO: 7).
- Two positive clones designated "lambda 5" and "lambda 8,” were obtained. Restriction mapping analysis showed that clone lambda 3 contains exons 2 and 3, while clone lambda 5 contains exon 1 and the putative promoter region.
- genomic VEGF-C PI plasmid clone 7660 Three genomic fragments containing exons 4, 5, 6 and 7 were subcloned from a genomic VEGF-C PI plasmid clone.
- purified DNA from a genomic PI plasmid clone 7660 (Paavonen et al, Circulation, 93: 1079-1082 (1996)) was used. EcoRI fragments ofthe PI insert DNA were ligated into pBSK II vector.
- Subclones of clone 7660 which contained human V ⁇ GF-C cDNA homologous sequences were identified by colony hybridization, using the full-length V ⁇ GF-C cDNA as a probe.
- Three different genomic fragments were identified and isolated, which contained the remaining exons 4-7.
- the second exon encodes the carboxy-terminal portion ofthe N-terminal propeptide and the amino terminus ofthe VEGF homology domain.
- the most conserved sequences ofthe VEGF homology domain are distributed in exons 3 (containing 6 conserved cysteine residues) and 4 (containing 2 cys residues).
- the remaining exons encode cysteine-rich motifs ofthe type C-6X-C-10X-CRC (exons 5 and 7) and a fivefold repeated motif of type C-6X-B-3X-C-C-C, which is typical of a silk protein.
- the lambda 5 clone was further analyzed. Restriction mapping of this clone using a combination of single- and double-digestions and Southern hybridizations indicated that it includes: (1) an approximately 6 kb region upstream ofthe putative initiator ATG codon, (2) exon 1, and (3) at least 5 kb of intron I ofthe VEGF-C gene.
- RNA start site was estimated to be about 550-700 bp upstream ofthe translation initiation codon. RNase protection assays were employed to obtain a more precise localization ofthe mRNA start site. The results of these experiments indicated that the RNA start site in the human VEGF-C gene is located 539 bp upstream ofthe ATG translational initiation codon.
- VEGF-C human VEGF-C gene
- a genomic clone encompassing about 2.4 kb upstream ofthe translation initiation site was isolated, and the 5' noncoding cDNA sequence and putative promoter region were sequenced.
- the sequence obtained is set forth in SEQ ID NO: 48.
- the beginning ofthe VEGF-C cDNA sequence set forth in SEQ ED NO: 7 corresponds to position 2632 of SEQ DD NO: 48; the translation initiation codon corresponds to positions 2983-2985 of SEQ DD NO: 48.
- the VEGF-C promoter is rich in G and C residues and lacks consensus TATA and CCAAT sequences.
- VEGF-C vascular endothelial growth factor
- AP-2 transcription factor AP-2 transcription factor
- the VEGF-C gene does not contain a binding site for the hypoxia-inducible factor, HIF-1 (Levy et al, J. Biol. Chem., 270: 13333-13340 (1995)).
- HIF-1 hypoxia-inducible factor
- the relative rate of VEGF mRNA stability and decay is considered to be determined by the presence of specific sequence motifs in its 3' untranslated region (UTR), which have been demonstrated to regulate mRNA stability. (Chen and Shyu, Mol. Cell Biol, 14: 8471-8482 (1994)).
- the 3'-UTR ofthe VEGF-C gene also contains a putative motif of this type (TTATTT), at positions 1873-1878 of SEQ DD NO: 7.
- TATTT putative motif of this type
- an Tforll fragment spanning nucleotides 214-495 i.e.,
- the VEGF gene has been shown to be up-regulated by a number of stimuli including serum derived growth factors. To find out whether the VEGF-C gene also can
- RNA from serum-starved and serum-stimulated HT1080 cells was subjected to primer extension analysis, which demonstrated that VEGF-C mRNA is up- regulated by serum stimulation.
- VEGF-C cDNA libraries from HT1080 cells in the lambda gtl 1 vector (Clontech, product #HL 1048b) was screened using a 153 bp human VEGF-C cDNA fragment as a probe as described in Example 10. See also Joukov et al, EMBO J., 75:290-298 (1996).
- oligonucleotides 5'-CACGGCTTATGCAAGCAAAG-3' SEQ DD NO: 49
- 5'-AACACAGTTTTCCATAATAG-3' SEQ DD NO: 50
- PCR products were electrophoresed on agarose gels. Five clones out ofthe nine analyzed generated PCR fragments ofthe expected length of 1147 base pairs, whereas one was slightly shorter. The shorter fragment and one ofthe fragments of expected length were cloned into the pCRTMII vector (Invitrogen) and analyzed by sequencing. The sequence revealed that the shorter PCR fragment had a deletion of 153 base pairs, corresponding to nucleotides 904 to 1055 of SEQ DD NO: 7. These deleted bases correspond to exon 4 ofthe human and mouse VEGF-C genes, schematically depicted in Figs. 13A and 13B.
- the polypeptide encoded by this splice variant would not contain the C-terminal cleavage site ofthe VEGF-C precursor.
- a putative alternatively spliced RNA form lacking conserved exon 4 was identified in HT-1080 fibrosarcoma cells and this form is predicted to encode a protein of 199 amino acid residues, which could be an antagonist of VEGF-C.
- Example 33 VEGF-C is similarly processed in different cell cultures in vitro
- VEGF-C vascular endothelial growth factor-C
- 293 EBNA cells, COS-1 cells and HT-1080 cells were transfected with wild type human VEGF-C cDNA and labelled with Pro-MixTM as described in Example 22.
- the conditioned media from the cultures were collected and subjected to immunoprecipitation using antiserum 882 (described in Example 21, recognizing a peptide corresponding to amino acids 104-120 of SEQ DD NO: 8).
- the immunoprecipitated polypeptides were separated via SDS-PAGE, and detected via autoradiography.
- the major form of secreted recombinant VEGF-C observed from all cell lines tested is a 29/32 kD doublet.
- Example 22 These two polypeptides are bound to each other by disulfide bonds, as described in Example 22. A less prominent band of approximately 21 kD also was detected in the culture media. Additionally, a non-processed VEGF-C precursor of 63 kDa was observed. This form was more prominent in the COS-1 cells, suggesting that proteolytic processing of VEGF-C in COS cells is less efficient than in 293 EBNA cells. Endogenous VEGF-C (in non- transfected cells) was not detectable under these experimental conditions in the HT-1080 cells, but was readily detected in the conditioned medium ofthe PC-3 cells.
- PC-3 cells were cultured in serum-free medium for varying periods of time (1 - 8 days) prior to isolation ofthe conditioned medium.
- the conditioned medium was concentrated using a Centricon device (Amicon, Beverly, USA) and subjected to Western blotting analysis using antiserum 882. After one day of culturing, a prominent 32 kD band was detected. Increasing amounts of a 21-23 kD form were detected in the conditioned media from 4 day and 8 day cultures.
- the diffuse nature of this polypeptide band which is simply called the 23 kD polypeptide in example 5 and several subsequent examples, is most likely due to a heterogenous and variable amount of glycosylation.
- the cells secrete a 32 kD polypeptide, which is further processed or cleaved in the medium to yield the 21-23 kD form.
- the microheterogeneity of this polypeptide band would then arise from the variable glycosylation degree and, from microheterogeneity ofthe processing cleavage sites, such as obtained for the amino terminus in PC-3 and 293 EBNA cell cultures.
- the carboxyl terminal cleavage site could also vary, examples of possible cleavage sites would be between residues 225-226, 226-227 and 227-228 as well as between residues 216-217.
- protease(s) are responsible for the generation ofthe 21-23 kD form of VEGF-C from the 32 kD polypeptide.
- proteases could be used in vitro to cleave VEGF-C precursor proteins in solution during the production of VEGF-C, or used in cell culture and in vivo to release biologically active VEGF-C.
- Example 34 Differential binding of VEGF-C forms by the extracellular domains of VEGFR-3 and VEGFR-2
- ⁇ N ⁇ CHis (Example 28) and about 48 hours after transfection, metabolically labelled with Pro-MixTM as described in previous examples.
- the media were collected from mock- transfected and transfected cells and used for receptor binding analyses.
- Receptor binding was carried out in binding buffer (PBS, 0.5% BSA, 0.02%) Tween 20, 1 microgram/ml heparin) containing approximately 0.2 microgram of either (a) a fusion protein comprising a VEGFR-3 extracellular domain fused to an immunoglobuhn sequence (VEGFR-3-Ig) or (b) a fusion protein comprising VEGFR-2 extracellular domain fused to an alkaline phosphatase sequence (VEGFR-2-AP; Cao et al, J. Biol. Chem. 277:3154-62 (1996)).
- binding buffer PBS, 0.5% BSA, 0.02%
- Tween 20 1 microgram/ml heparin
- anti-VEGF-C antibodies and VEGFR-3-Ig protein were adsorbed to protein A-sepharose (PAS) and VEGFR-2-AP was immunoprecipitated using anti-AP monoclonal antibodies (Medix Biotech, Genzyme Diagnostics, San Carlos, CA, USA) and protein G-sepharose.
- VEGFR-3 bound to both the 32/29 kD and 21-23 kD forms of recombinant VEGF-C
- VEGFR-2 bound preferentially to 5 the 21-23 kD component from the conditioned media.
- small amounts of 63 kD and 52 kD VEGF-C forms were observed binding with VEGFR-3.
- Further analysis under nonreducing conditions indicates that a great proportion ofthe 21-23 kD VEGF-C bound to either receptor does not contain interchain disulfide bonds.
- VEGF-C polypeptide mutants that bind to a VEGF- C receptor but fail to activate the receptor are useful as VEGF-C antagonists.
- VEGF- C ⁇ N ⁇ CHisC156S an additional VEGF-C mutant, designated VEGF- C ⁇ N ⁇ CHisC156S, was synthesized, in which the cysteine residue at position 156 ofthe 25 419 amino acid VEGF-C precursor (SEQ DD NO: 8; Genbank accession number X94216) was replaced with a serine residue.
- mutagenesis procedure was carried out using the construct of VEGF- C ⁇ N ⁇ CHis (see Example 28), cloned in the pALTER vector, and the Altered sites II in vitro mutagenesis system of Promega.
- VEGF-C R226,227S, VEGF-C ⁇ N ⁇ CHis, and VEGF-C ⁇ N ⁇ CHisC156S were used to transfect 293 EBNA cells, which were subcultured 16 hours after transfection. About 48 hours after transfection, the media were changed to DMEM/0.1% BSA, and incubation in this medium was continued for an additional 48 hours. The resultant conditioned media were concentrated 30-fold using Centriprep-10 (Amicon), and the amount of VEGF-C in the media was analyzed by Western blotting using the anti- VEGF-C antiserum 882 for immunodetection.
- VEGF-C ⁇ N ⁇ CHis Different amounts ofthe recombinant VEGF-C ⁇ N ⁇ CHis, purified from a yeast expression system, were analyzed in parallel as reference samples to measure and equalize the VEGF-C concentrations in the conditioned media.
- the conditioned medium from mock-transfected cells was used to dilute the VEGF-C conditioned media to achieve equal concentrations.
- VEGF-C vascular endothelial growth factor-C
- VEGFR-2EC domain preferentially bound the mature 21 kDa form of wildtype VEGF-C and VEGF-C ⁇ N ⁇ CHis.
- VEGF-C ⁇ N ⁇ CHisC156S failed to bind the VEGFR2-EC.
- Ten micrograms ofthe purified yeast VEGF-C ⁇ N ⁇ CHis was labeled using 3 mCi of Iodine- 125, carrier-free (Amersham), and an Iodo-Gen Iodination Reagent (Pierce), according to the standard protocol of Pierce. The resulting specific activity ofthe labeled VEGF-C ⁇ N ⁇ CHis was 1.25xl0 5 cpm ng.
- P AE/VEGFR-2 and PAE/VEGFR-3 cells were seeded into 24-well tissue culture plates (Nunclon), which had been coated with 2% gelatin in PBS.
- the 125 I- VEGF-C ⁇ N ⁇ CHis (2xl0 5 cpm) and different amounts of media containing equal concentrations ofthe non-labeled VEGF-C (wildtype and mutants) were added to each plate in Ham's F12 medium, containing 25 mM HEPES (pH 8.0), 0.1% BSA, and 0.1% NaN 3 .
- the binding was allowed to proceed at room temperature for 90 minutes.
- the plates were then transferred onto ice and washed three times with ice-cold PBS containing 0.1% BSA.
- VEGF-C-containing conditioned medium Binding in the presence of VEGF-C-containing conditioned medium was calculated as a percentage of binding observed in parallel control studies wherein equal volumes of medium from mock- transfected cells were used instead of VEGF-C conditioned media.
- VEGF-C mutants displaced 125 I-VEGF- C ⁇ N ⁇ CHis from VEGFR-3.
- the efficiency of displacement was as follows: VEGF- C ⁇ N ⁇ CHisC156S > VEGF-C ⁇ N ⁇ CHis > wildtype VEGF-C > VEGF-CR226,227S.
- VEGF, VEGF-C ⁇ N ⁇ CHis, and wildtype VEGF-C all efficiently displaced labeled VEGF-C ⁇ N ⁇ CHis from VEGFR-2, with VEGF-C ⁇ N ⁇ CHis being more potent when compared to wildtype VEGF-C (Fig. 4, right panel).
- the non-processed VEGF-C R226,227S showed only weak competition of 125 I- VEGF-C ⁇ N ⁇ CHis.
- VEGF-C ⁇ N ⁇ CHisR156S failed to displace VEGF- C ⁇ N ⁇ CHis from VEGFR-2, thus confirming the above described results obtained using a soluble extracellular domain of VEGFR-2.
- the ability ofthe above mentioned VEGF-C forms to stimulate tyrosine phosphorylation of VEGFR-3 and VEGFR-2 was also investigated. Importantly, identical dilutions ofthe conditioned media were used for these experiments and for the competitive binding experiments described above. A Western blot analysis ofthe conditioned media using anti- VEGF-C antiserum 882 was performed to confirm the approximately equal relative amounts ofthe factors present.
- VEGFR-3 and VEGFR-2 autophosphorylation by the different VEGF-C forms in general correlated with their binding properties, as well as with the degree of "recombinant processing" of VEGF-C.
- the VEGF-C ⁇ N ⁇ CHisC156S appeared to be at least as potent as VEGF-C ⁇ N ⁇ CHis in stimulating VEGFR-3 autophosphorylation.
- VEGF-C ⁇ N ⁇ CHis showed a higher potency when compared to wildtype VEGF-C in its ability to stimulate tyrosine autophosphorylation of both VEGFR- 2 and VEGFR-3.
- the VEGF-CR226,227S conditioned medium possessed a considerably weaker effect on autophosphorylation of VEGFR-3, and almost no effect on VEGFR-2 autophosphorylation.
- VEGFR-2 tyrosine phosphorylation by VEGF- C ⁇ N ⁇ CHisC156S did not differ from that of conditioned medium from the mock transfected cells, thus confirming the lack of VEGFR-2-binding and VEGFR-2-activating properties of this mutant.
- the ability of VEGF-C ⁇ N ⁇ CHisC 156S to alter vascular permeability in vivo was analyzed using the Miles assay (see Example 29).
- VEGF-C forms assayed were produced by 293 cells, purified from conditioned media using Ni-NTA Superflow resin (QIAGEN) as previously described, and pretreated with 15 ⁇ g/ml of anti-human VEGF neutralizing antibody (R&D systems) to neutralize residual amounts of co-purified, endogenously produced VEGF.
- VEGF-C Eight picomoles ofthe various VEGF-C forms, as well as 2 pmol of recombinant human VEGF 165 (R&D systems) and approximately 2 pmol of VEGF 165 from the conditioned medium which were either non-treated or pretreated with the above mentioned VEGF- neutralizing antibody were injected subcutaneously to the back region of a guinea pig. The area of injection was analyzed 20 minutes after injections. Both VEGF and VEGF-C ⁇ N ⁇ CHis caused increases in vascular permeability, whereas ⁇ N ⁇ CHisC156S did not affect vascular permeability. The neutralizing antibody completely blocked permeability activity of VEGF but did not affect VEGF-C activity.
- C ⁇ N ⁇ CHisC156S to stimulate migration of bovine capillary endothelial cells in a collagen gel was analyzed.
- the Miles assay also was used to assay the ability of VEGF-C R226,227S (8 pM, pretreated with anti- VEGF antibody) to induce vascular permeability.
- this Miles assay data is consistent with the VEGFR-2 binding and autophosphorylation data described above, and indicates that VEGF-C effect on vascular permeability is mediated via VEGFR-2.
- Mitogenic signals from growth factor receptors are frequently relayed via the extracellular signal regulated kinases/mitogen activated protein kinases (ERK/MAPK) pathway into the nucleus.
- ERK/MAPK extracellular signal regulated kinases/mitogen activated protein kinases
- Purified recombinant VEGF-C ⁇ N ⁇ CHis and VEGF-C ⁇ N ⁇ C156S produced by a Pichia expression system were used to determine MAPK pathway activation of cells expressing either VEGFR-2 or VEGFR-3.
- the growth factor treated cells were lysed, and activated MAPK was detected using Western blotting with antibodies against the phosphorylated forms of ERKl and ERK2.
- VEGF-C ⁇ N ⁇ CHis showed rapid activation ofthe ERKl and ERK2 MAPK in both VEGFR-2- and VEGFR-3 -expressing cells.
- VEGF-C ⁇ N ⁇ C156S activated ERKl and ERK2 exclusively in the VEGFR-3 -expressing cells.
- both VEGF-C ⁇ N ⁇ CHis and VEGF-C ⁇ N ⁇ C156S appeared to be equally potent in activating the MAPK through VEGFR-3.
- the amounts of total MAPK protein were confirmed to be similar in the treated and untreated cells, as shown by staining ofthe filter with p44/p42 MAPK antibodies made against a synthetic peptide of rat p42.
- Non- processed VEGF-C is a ligand and an activator of preferentially VEGFR-3, while the mature 21/23 kDa VEGF-C form is a high affinity ligand and an activator of both VEGFR- 3 and VEGFR-2.
- VEGF-C ⁇ C 156 polypeptides are contemplated as aspects ofthe present invention.
- VEGF-C ⁇ C ⁇ 56 polypeptides ofthe invention derived from human VEGF-C include polypeptides depicted in SEQ DD
- VEGF-C ⁇ C 156 polypeptides also include the corresponding polypeptides derived from murine, quail, and other wildtype VEGF-C polypeptides.
- VEGF-C polypeptides that have the C 156S mutation (or functionally equivalent mutations at position 156) and that retain biological activity with respect to VEGFR-3, such as VEGF-C ⁇ N ⁇ CHisC156S, are useful in all ofthe same manners described above for wildtype VEGF-C proteins and biologically active fragments thereof where VEGFR-3 stimulation is desired. It is contemplated that most biologically active
- VEGF-C fragments and processing variants including but not limited to the biologically active fragments and variants identified in preceding examples, will retain VEGF-C biological activity (as mediated through VEGFR-3) when a ⁇ C 156 mutation is introduced. All such biologically active VEGF-C ⁇ C 156 polypeptides are intended as an aspect ofthe present invention.
- VEGF-C forms containing the C156S mutation or equivalent mutations can be used to distinguish those effects of VEGF-C mediated via VEGFR-3 and VEGFR-2 from those obtained via only VEGFR-3.
- the ability of such VEGF-C polypeptides to selectively stimulate VEGFR-3 are also expected to be useful in clinical practice, it being understood that selectivity of a pharmaceutical is highly desirable in many clinical contexts.
- VEGF-C ⁇ C 156 polypeptides for VEGFR- 3 binding suggests a utility for these peptides to modulate VEGF-C biological activities mediated through VEGFR-3, without significant concomitant modulation of blood vessel permeability or other VEGF-C activities that are modulated through VEGFR-2.
- the data presented herein also indicates a utility for ⁇ C 1S6 polypeptides that are capable of binding VEGFR-3, but that do not retain biological activity mediated through VEGFR-3. Specifically, such forms are believed to be capable of competing with wildtype VEGF-C for binding to VEGFR-3, and are therefore contemplated as molecules that inhibit VEGF-C-mediated stimulation of VEGFR-3. Because ofthe ⁇ C 156 alteration, such polypeptides (especially covalent or noncovalent dimers of such polypeptides) are not expected to bind VEGFR-2.
- ⁇ C 156 polypeptides and polypeptide dimers are expected to have utility as selective inhibitors of VEGF-C biological activity mediated through VEGFR-3 (i.e., without substantially altering VEGF-C mediated stimulation of VEGFR-2).
- heterodimers comprising a biologically active VEGF-C polypeptide in association with a ⁇ C 156 polypeptide are contemplated. It is contemplated that such heterodimers can be formed in vitro, as described below in Example 37, or formed in vivo with endogenous VEGF-C following administration of a ⁇ C 156 polypeptide. Such heterodimers are contemplated as modulators of VEGF-C mediated effects in cells where the biological effects of VEGF-C are mediated through VEGFR-2/VEGFR-3 heterodimers. VEGF-C ⁇ C 156 polypeptides in homodimers or in heterodimers with wt VEGF-C might selectively inhibit the ability ofthe latter to induce VEGF-like effects, particularly to increase the vascular permeability.
- VEGF-C replacement ofthe second and/or the fourth ofthe eight conserved cysteine residues of VEGF abolishes VEGF dimer formation and VEGF biological activity.
- the analogous effect was investigated for VEGF-C, wherein the cysteines at positions 156 and 165 of SEQ DD NO: 8 correspond to the second and fourth conserved cysteines. No homodimers were obtained when VEGF-C ⁇ N ⁇ CHisC 156,165 S (i.e., Cys 156 and Cys 165 both replaced with serine residues) or in VEGF-C ⁇ N ⁇ CHisC 165 S were chemically crosslinked.
- VEGF-C vascular endothelial growth factor-C
- VEGF-C overexpression of VEGF-C in the skin ofthe transgenic mice correlates with a distinct alteration in leukocyte populations.
- the measured populations of neutrophils were markedly increased in the transgenic mice.
- One explanation for the marked increase in neutrophils is a myelopoietic activity attributable to VEGF-C.
- a VEGF-C influence on leukocyte trafficking in and out of tissues also may effect observed neutrophil populations.
- Fluorescence-activated cell sorting analysis performed on isolated human bone marrow and umbilical cord blood CD34-positive hematopoietic cells, demonstrated that a fraction of these cells are positive for Flt4 (VEGFR-3).
- the VEGF-C effect on myelopoiesis may be exerted through this VEGFR-3 -positive cell population and its receptors.
- the foregoing data indicates a use for VEFG-C polypeptides to increase granulocyte (and, in particular, neutrophil) counts in human or non-human subjects, i.e., in order to assist the subject fight infectious diseases.
- the exploitation ofthe myelopoietic activity of VEGF-C polypeptides is contemplated both in vitro (i.e., in cell culture) and in vivo, as a sole myelopoietic agent and in combination with other effective agents (e.g., granulocyte colony stimulating factor 5 (G-CSF)).
- G-CSF granulocyte colony stimulating factor 5
- VEGF-C mutants e.g., VEGF-C ⁇ C 156 polypeptides, VEGF-C ⁇ N ⁇ CHis, VEGF-C R226,227S
- VEGFR-2 binding affinities e.g., VEGFR-2, VEGFR-3, or both receptors, for example.
- the results of such 10 analysis will be useful in determining which VEGF-C mutants have utility as myelopoietic agents and which have utility as agents for inhibiting myelopoiesis.
- heterodimers of polypeptides ofthe PDGF/VEGF family of growth factors have been shown to exist in nature and possess mitogenic activities. See, e.g., Cao et al, J. Biol. Chem., 277:3154-62 (1996); and DiSalvo, et al, J.Biol.Chem., 270:1111-1123 (1995).
- Heterodimers comprising a VEGF-C polypeptide may be generated essentially as described In Cao et al.
- VEGF-C polypeptides such as the VEGF-C polypeptides described in the preceding examples.
- a recombinantly produced VEGF-C polypeptide is mixed at an equimolar ratio with another recombinantly produced polypeptide of interest, such as a VEGF, VEGF-B, PIGF, PDGF ⁇ , PDGF ⁇ , or c-fos induced growth factor polypeptide.
- the thiol groups are then protected with S-sulfonation, and the protein is dialyzed overnight, initially against urea/glutathione-SH, glutathione-S-S-glutathione, and subsequently against 20 mM Tris-HCl.
- VEGF-C polypeptide used to generate such heterodimers.
- the heterodimers are screened to determine their binding affinity with respect to receptors ofthe VEGF/PDGF family (especially VEGFR-1, VEGFR-2, and VEGFR-3), and their ability to stimulate the receptors (e.g., assaying for dimer-stimulated receptor phosphorylation in cells expressing the receptor of interest on their surface).
- the binding assays may be competitive binding assays such as those described herein and in the art.
- recombinantly produced proteins comprising the extracellular domains of receptors are employable, as described in preceding examples for VEGFR-2 and VEGFR-3.
- Heterodimers that bind and stimulate receptors are useful as recombinant growth factor polypeptides.
- Heterodimers that bind but do not stimulate receptors are useful as growth factor antagonists.
- Heterodimers that display agonistic or antagonistic activities in the screening assays are further screened using, e.g., endothelial cell migration assays, vascular permeability assays, and in vivo assays.
- dimers comprising two VEGF-C polypeptides are advantageously screened for agonistic and antagonistic activities using the same assays.
- VEGF-C ⁇ C 156 polypeptide is employed to make the dimers. It is anticipated that agonists and antagonists comprising a VEGF-C ⁇ C ⁇ 56 polypeptide will have increased specificity for stimulating and inhibiting VEGFR-3, without concomitant stimulation or inhibition of VEGFR-2.
- VEGF-C polypeptides wherein the C- terminal proteolytic cleavage site has been altered to reduce or eliminate C-terminal processing (e.g. VEGF-C R226,227S) is employed to make dimers for screening for inhibitory activity.
- VEGF-C polypeptides comprising amino-terminal fragments (e.g., the VEGF-C 15 kD form described herein) of VEGF-C are employed to make dimers.
- inhibition is achieved by expression in vivo of a polynucleotide (e.g., a cDNA construct) encoding the heterodimerization partner which is unable to bind (or binds inefficiently) to the receptor, or by direct administration of that monomer in a pharmaceutical composition.
- a polynucleotide e.g., a cDNA construct
- mature VEGF-C contains an unpaired cysteine (position 137 of SEQ DD NO: 8) and is able to form non- covalently bonded polypeptide dimers.
- a VEGF analog is created wherein the unpaired cysteine residue from mature VEGF-C is introduced at an analogous position of VEGF (e.g., introduced at Leu 58 ofthe human
- VEGF 165 precursor (Fig. 2, Genbank Ace. No. M32977) to generate a VEGF +cys mutant designated VEGF L58C).
- a VEGF +cys mutant designated VEGF L58C.
- This VEGF +cys mutant is recombinantly expressed and is screened (alone and as a heterodimer with other VEGF and VEGF-C forms) for VEGFR-2 and/or VEGFR-3 binding, stimulatory, and inhibitory activities, using in vitro and in vivo activity assays as described elsewhere herein.
- a VEGF +cys mutant is altered to remove a conserved cysteine corresponding to cys 77 ofthe VEGF 165 precursor. Elimination of this cysteine from the VEGF L58C would result in a VEGF analog resembling VEGF-C ⁇ N ⁇ CHisC156S.
- This VEGF analog is screened for its VEGF-inhibitory activities with respect to VEGFR-2 and/or VEGFR-1 and for VEGF-C like stimulatory or inhibitory activities.
- VEGF-C Another noteworthy structural difference between VEGF and VEGF-C is the absence in VEGF-C of several basic residues found in VEGF (e.g., residues Arg 10g , Lys uo and His 112 in the VEGF165 precursor shown in Fig. 2) that have been implicated in VEGF receptor binding. See Keyt et al, J. Biol. Chem., 271(10 :5638-46 (1996).
- codons for basic residues (lys, arg, his) are substituted into the VEGF-C coding sequence at one or more analogous positions by site- directed mutagenesis.
- VEGF-C vascular endothelial growth factor-C
- SEQ DD NO: 8 Glu lg7 , Thr 189 , and Pro 19 ⁇ in VEGF-C
- VEGF-C vascular endothelial growth factor-C
- VEGF-C basic " polypeptides are recombinantly expressed and screened for VEGFR-1, VEGFR-2, and VEGFR-3 stimulatory and inhibitory activity.
- the foregoing VEGF and VEGF-C analogs that have VEGF-like activity, VEGF-C-like activity, or that act as inhibitors of VEGF or VEGF-C, are contemplated as additional aspects ofthe invention.
- Polynucleotides encoding the analogs also are intended as aspects ofthe invention.
- VEGF-C was added, at concentrations ranging from 10 ng/ml to 1 ⁇ g/ml, to the cultures of CB CD34+ HPCs. Cell numbers were evaluated at day 7 of culture. When added as a single factor, 100 ng/ml of VEGF-C was found support the survival and proliferation of only a few CD34+ HPCs under serum-free conditions. With medium alone, most ofthe cells died within a culture period of 7 days. However, there were consistently more cells in the cultures provided with the VEGF-C.
- VEGF-C co-stimulatory effect of VEGF-C in cultures either supplemented with recombinant human stem cell factor (rhSCF, 20 ng/ml PreproTech, Rocky Hill, NY) alone or a combination of granulocyte macrophage colony stimulating factor (rhGM-CSF, 100 ng/ml, Sandoz, Basel, Switzerland) plus SCF.
- rhSCF human stem cell factor
- rhGM-CSF granulocyte macrophage colony stimulating factor
- SCF granulocyte macrophage colony stimulating factor
- VEGF-C additive-supplemented cultures clearly increased cell yields after 7 days of culture, with an optimum VEGF-C concentration of 100 ng/ml. Additional experiments were conducted to analyze the co- stimulatory effects of 100 ng/ml VEGF-C on total cell yields of serum-free cultures of CB CD34+ HPC cells supplemented with either GM-CSF alone, IL-3 (rhIL-3, 100 U/ml, Behring AG, Marburg, Germany) alone; or a combination of GM-CSF plus DL-3. The results are shown below in the following table:
- VEGF-C led to a consistent enhancement of cell growth when added as a supplement to each growth factor or combination of growth factors tested.
- VEGF-C Effect of VEGF-C on granulomonocytic differentiation of CD34+ progenitors Using cells from the (7 day) plasma-supplemented cultures described above, immunofluorescence triple stainings were performed to analyze the expression of the early granulomonocytic marker molecules lysozyme (LZ) and myeloperoxidase (MPO) as well as the lipopolysaccharide (LPS) receptor CD 14.
- LZ lysozyme
- MPO myeloperoxidase
- LPS lipopolysaccharide
- LZ+CD14+ cells which represent differentiated monocytic cells only very slightly increased upon addition of VEGF-C (data not shown).
- Co-stimulation ofthe cells with VEGF-C increased the expression of MPO, an early granulocytic marker molecule, only modestly, except in combination with both GM-CSF and E -3, where the increase in the proportion of MPO+ cells was more pronounced.
- CD34+ cells were cultured in medium supplemented with 50 ng/ml M-CSF, with or without 100 ng/ml VEGF-C, for seven days.
- Culture of CD34+ cells in the presence of M-CSF leads to the generation of CD14+ monocytes within 7 days.
- the cultures were analyzed to determine the percentages of CD 14+ cells and mean fluorescence intensity. The results are summarized in the table below:
- VEGF-C As shown in the table, addition of VEGF-C to these cultures increased both the proportion of CD 14+ cells (37% CD 14+ cells vs. 46%) and the fluorescence intensity of CD 14 expression (MFI 23.3 vs. 40.3). However, cell numbers did not increase upon addition of VEGF-C to M-CSF supplemented cultures. Thus, VEGF-C had a small effect on the differentiation of monocytic cells, but not on their growth.
- VEGF-C vascular endothelial growth factor-C
- compositions comprising VEGF-C prepared in admixture with the aforementioned or other growth factors, such as VEGF-C, and unit dose formulations comprising VEGF-C packaged together with the aforementioned or other growth factors.
- Such compositions, unit dose formulations, and methods of their use are intended as further aspects ofthe present invention.
- Plasmid FLT4-L has been deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Dr., Rockville MD 20952 (USA), pursuant to the provisions ofthe Budapest Treaty, and has been assigned a deposit date of 24 July 1995 and ATCC accession number 97231.
- VEGF-C Vascular Endothelial Growth Factor C
- CTTCCTTTCC AACCCCTTCC TGGTGCACAT CACAGGCAAC GAGCTCTATG ACATCCAGCT 720
- CTACTCGCGT CACAGCCGCC AGGCCCTCAC CTGCACGGCC TACGGGGTGC CCCTGCCTCT 1380
- TCCGCGCATC CATGCCCCCG AACTGCAGGA GTGGGGAGGC ACGATGGCCG CTTTGGTCCC 2 0
- ACTACGGCTA CACTAGAAGG ACAGTATTTG GTATCTGCGC TCTGCTGAAG CCAGTTACCT 1860
- CTGTGCCTTA TTTGAACTAA CCAATCAGTT CGCTTCTCGC TTCTGTTCGC GCGCTTCTGC 4200
- CTCGCTTCAC CTCGCGGGCT CCGAATGCGG GGAGCTCGGA TGTCCGGTTT CCTGTGAGGC 120
- TGT CAG CTA AAA GGA GGC TGG CAA CAT AAC AGA GAA CAG GCC AAC 645 Cys Gin Leu Arg Lys Gly Gly Trp Gin His Asn Arg Glu Gin Ala Asn 85 90 95
- Glu Glu Thr lie Lys Phe Ala Ala Ala His Tyr Asn Thr Glu lie Leu 1 5 10 15
- GAA GGC AAA GAC CTG GAG GAG CAG TTG CGG TCT GTG TCC
- AGC GTA GAT 368 Glu Gly Lys Asp Leu Glu Glu Gin Leu Arg Ser Val Ser Val Asp 55 60 65
- Asp Phe lie Phe Tyr Ser Asn Val Glu Asp Asp Ser Thr Asn Gly Phe 260 265 270
Abstract
Description
Claims
Priority Applications (16)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE69839340T DE69839340T2 (en) | 1997-02-05 | 1998-02-02 | Mutants of the VASCULAR, ENDOTHELCELL SPECIFIC GROWTH FACTOR C (VEGF-C) AND THEIR USES |
EP98904842A EP0972028B1 (en) | 1997-02-05 | 1998-02-02 | Mutants of vascular endothelial growth factor c (vegf-c) and uses thereof |
JP53317898A JP4524340B2 (en) | 1997-02-05 | 1998-02-02 | Vascular endothelial growth factor C (VEGF-C) protein and its genes, variants, and uses thereof |
AU62624/98A AU748369C (en) | 1997-02-05 | 1998-02-02 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof,and uses thereof |
CA2279554A CA2279554C (en) | 1997-02-05 | 1998-02-02 | Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof |
US09/355,700 US6361946B1 (en) | 1997-02-05 | 1998-02-02 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
US10/201,386 US7125714B2 (en) | 1997-02-05 | 2002-07-23 | Progenitor cell materials and methods |
AU2002300880A AU2002300880C1 (en) | 1997-02-05 | 2002-08-30 | Vascular Endothelial Growth Factor C (VEGF-C) Protein and Gene, Mutants Thereof, and Uses Thereof |
US10/792,480 US7727761B2 (en) | 1995-08-01 | 2004-03-03 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
US10/792,461 US7423125B2 (en) | 1995-08-01 | 2004-03-03 | Antibodies to VEGF-C |
US11/929,975 US7794756B1 (en) | 1995-08-01 | 2007-10-30 | Methods of using antibodies to VEGF-C |
US11/930,008 US7709270B2 (en) | 1995-08-01 | 2007-10-30 | Vascular endothelial growth factor C (VEGF-C) protein diagnostic |
US11/929,936 US20090104198A1 (en) | 1995-08-01 | 2007-10-30 | Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof |
US11/930,021 US7807412B2 (en) | 1995-08-01 | 2007-10-30 | VEGF-C ΔR226ΔR227 mutants and uses thereof |
US12/879,740 US8282931B2 (en) | 1995-08-01 | 2010-09-10 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
US13/646,563 US8637262B2 (en) | 1995-08-01 | 2012-10-05 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/340,011 US5776755A (en) | 1992-10-09 | 1994-11-14 | FLT4, a receptor tyrosine kinase |
US08/510,133 US6221839B1 (en) | 1994-11-14 | 1995-08-01 | FIt4 ligand and methods of use |
US08/585,895 US6245530B1 (en) | 1995-08-01 | 1996-01-12 | Receptor ligand |
US08/601,132 US6403088B1 (en) | 1995-08-01 | 1996-02-14 | Antibodies reactive with VEGF-C, a ligand for the Flt4 receptor tyrosine kinase (VEGFR-3) |
US08/671,573 US6645933B1 (en) | 1995-08-01 | 1996-06-28 | Receptor ligand VEGF-C |
PCT/FI1996/000427 WO1997005250A2 (en) | 1995-08-01 | 1996-08-01 | Receptor ligand vegf-c |
US08/795,430 | 1997-02-05 | ||
US08/795,430 US6130071A (en) | 1997-02-05 | 1997-02-05 | Vascular endothelial growth factor C (VEGF-C) ΔCys156 protein and gene, and uses thereof |
Related Parent Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/795,430 Continuation-In-Part US6130071A (en) | 1994-11-14 | 1997-02-05 | Vascular endothelial growth factor C (VEGF-C) ΔCys156 protein and gene, and uses thereof |
US11/930,021 Continuation-In-Part US7807412B2 (en) | 1995-08-01 | 2007-10-30 | VEGF-C ΔR226ΔR227 mutants and uses thereof |
US12/879,740 Continuation-In-Part US8282931B2 (en) | 1995-08-01 | 2010-09-10 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
Related Child Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09355700 A-371-Of-International | 1998-02-02 | ||
US09/355,700 A-371-Of-International US6361946B1 (en) | 1995-08-01 | 1998-02-02 | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
US09/534,376 Continuation US6818220B1 (en) | 1994-11-14 | 2000-03-24 | Vascular endothelial growth factor C (VEGF-C) protein and gene mutants thereof, and uses thereof |
US09/534,376 Continuation-In-Part US6818220B1 (en) | 1994-11-14 | 2000-03-24 | Vascular endothelial growth factor C (VEGF-C) protein and gene mutants thereof, and uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1998033917A1 true WO1998033917A1 (en) | 1998-08-06 |
WO1998033917A9 WO1998033917A9 (en) | 1999-09-02 |
Family
ID=27559783
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/001973 WO1998033917A1 (en) | 1994-11-14 | 1998-02-02 | Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO1998033917A1 (en) |
Cited By (43)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6040157A (en) * | 1994-03-08 | 2000-03-21 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
WO2000021560A1 (en) | 1998-10-09 | 2000-04-20 | Ludwig Institute For Cancer Research | Flt4 (VEGFR-3) AS A TARGET FOR TUMOR IMAGING AND ANTI-TUMOR THERAPY |
WO2000024412A2 (en) * | 1998-10-26 | 2000-05-04 | Ludwig Institute For Cancer Research | Use of vegf-c or vegf-d gene or protein to prevent restenosis |
WO2000027414A2 (en) * | 1998-11-06 | 2000-05-18 | Basf Aktiengesellschaft | Inhibition of the formation of vascular hyperpermeability |
EP1062319A1 (en) * | 1998-03-13 | 2000-12-27 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
WO2001025277A1 (en) * | 1999-10-07 | 2001-04-12 | Maxygen Aps | Single-chain antagonist polypeptides |
WO2001062942A2 (en) * | 2000-02-25 | 2001-08-30 | Ludwig Institute For Cancer Research | MATERIALS AND METHODS INVOLVING HYBRID VASCULAR ENDOTHELIAL GROWTH FACTOR DNAs AND PROTEINS AND SCREENING METHODS FOR MODULATORS |
EP1140175A2 (en) * | 1998-12-21 | 2001-10-10 | Ludwig Institute For Cancer Research | Antibodies to truncated vegf-d and uses thereof |
EP1155117A1 (en) * | 1998-12-30 | 2001-11-21 | Millennium Pharmaceuticals, Inc. | Secreted proteins and nucleic acids encoding them |
WO2002057299A2 (en) * | 2001-01-17 | 2002-07-25 | Ludwig Institute For Cancer Research | Vegfr-3 binding peptides and their use for inhibiting angiogenesis |
US6451764B1 (en) | 1995-09-08 | 2002-09-17 | Genentech, Inc. | VEGF-related protein |
US6608182B1 (en) | 1994-03-08 | 2003-08-19 | Human Genome Sciences, Inc. | Human vascular endothelial growth factor 2 |
WO2003080640A1 (en) * | 2002-03-07 | 2003-10-02 | Ludwig Institute For Cancer Research | Lymphatic and blood endothelial cell genes |
US6734285B2 (en) | 1994-03-08 | 2004-05-11 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 proteins and compositions |
US6764820B2 (en) | 1999-03-26 | 2004-07-20 | Ludwig Institute For Cancer Research | Screening for lymphatic disorders involving the FLT4 receptor tyrosine kinase (VEGFR-3) |
US6824777B1 (en) | 1992-10-09 | 2004-11-30 | Licentia Ltd. | Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy |
EP1568375A1 (en) * | 1998-10-26 | 2005-08-31 | Ludwig Institute For Cancer Research | Use of VEGF-C or VEGF-D gene or protein to prevent restenosis |
US6958147B1 (en) | 1998-10-26 | 2005-10-25 | Licentia Ltd | Use of VEGF-C to prevent restenosis |
US7026462B2 (en) | 2000-12-07 | 2006-04-11 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
US7067317B2 (en) | 2000-12-07 | 2006-06-27 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
US7109308B1 (en) | 1994-03-08 | 2006-09-19 | Human Genome Sciences, Inc. | Antibodies to human vascular endothelial growth factor 2 |
US7153827B1 (en) | 1994-03-08 | 2006-12-26 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 and methods of use |
WO2007022287A2 (en) | 2005-08-15 | 2007-02-22 | Vegenics Limited | Modified vegf and pdgf with improved angiogenic properties |
US7186688B1 (en) | 1994-03-08 | 2007-03-06 | Human Genome Sciences, Inc. | Methods of stimulating angiogenesis in a patient by administering vascular endothelial growth factor 2 |
US7208582B2 (en) | 2001-04-13 | 2007-04-24 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7223724B1 (en) | 1999-02-08 | 2007-05-29 | Human Genome Sciences, Inc. | Use of vascular endothelial growth factor to treat photoreceptor cells |
US7227005B1 (en) | 1994-03-08 | 2007-06-05 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7273751B2 (en) | 2000-08-04 | 2007-09-25 | Human Genome Science, Inc. | Vascular endothelial growth factor-2 |
US7358085B2 (en) | 2005-02-28 | 2008-04-15 | Sangamo Biosciences, Inc. | Anti-angiogenic methods and compositions |
US7402312B2 (en) | 2001-04-13 | 2008-07-22 | Human Genome Sciences, Inc. | Antibodies to vascular endothelial growth factor 2 (VEGF-2) |
US7498417B2 (en) | 1994-03-08 | 2009-03-03 | Human Genome Sciences, Inc. | Antibodies to vascular endothelial growth factor 2 and methods of using same |
US7507705B2 (en) | 1997-10-02 | 2009-03-24 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Methods for the modulation of neovascularization and/or the growth of collateral arteries and/or other arteries from preexisting arteriolar connections |
US7740841B1 (en) | 2000-01-28 | 2010-06-22 | Sunnybrook Health Science Center | Therapeutic method for reducing angiogenesis |
US7829536B2 (en) | 1999-03-26 | 2010-11-09 | Vegenics Limited | Method of treating lymphedema comprising administering VEGF-D |
US7846437B2 (en) | 2004-03-05 | 2010-12-07 | Vegenics Limited | Chimeric anti-VEGF-D antibodies and humanized anti-VEGF-D antibodies and methods of using same |
US8282931B2 (en) | 1995-08-01 | 2012-10-09 | Vegenics Pty Limited | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
EP2548578A1 (en) | 2006-05-17 | 2013-01-23 | The Ludwig Institute for Cancer Research | Targeting VEGF-B regulation of fatty acid transporters to modulate human diseases |
US8642010B2 (en) | 2002-03-01 | 2014-02-04 | Dyax Corp. | KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy |
WO2014182635A1 (en) | 2013-05-08 | 2014-11-13 | Baldwin Megan E | Biomarkers for age-related macular degeneration (amd) |
US8940695B2 (en) | 2001-01-19 | 2015-01-27 | Vegenics Pty Limited | Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy |
US9056138B2 (en) | 2002-03-01 | 2015-06-16 | Bracco Suisse Sa | Multivalent constructs for therapeutic and diagnostic applications |
US9745558B2 (en) | 2013-02-18 | 2017-08-29 | Vegenics Pty Limited | VEGFR-3 ligand binding molecules and uses thereof |
WO2023073526A1 (en) | 2021-10-25 | 2023-05-04 | Novartis Ag | Methods for improving adeno-associated virus (aav) delivery |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7794693B2 (en) | 2002-03-01 | 2010-09-14 | Bracco International B.V. | Targeting vector-phospholipid conjugates |
US8623822B2 (en) | 2002-03-01 | 2014-01-07 | Bracco Suisse Sa | KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996039515A1 (en) * | 1995-06-06 | 1996-12-12 | Human Genome Sciences, Inc. | Human vascular endothelial growth factor 2 |
WO1997005250A2 (en) * | 1995-08-01 | 1997-02-13 | Helsinki University Licensing Ltd. Oy | Receptor ligand vegf-c |
WO1997009427A1 (en) * | 1995-09-08 | 1997-03-13 | Genentech, Inc. | Vegf-related protein |
WO1997017442A1 (en) * | 1995-11-08 | 1997-05-15 | Immunex Corporation | Flk-1 binding protein |
-
1998
- 1998-02-02 WO PCT/US1998/001973 patent/WO1998033917A1/en active IP Right Grant
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996039515A1 (en) * | 1995-06-06 | 1996-12-12 | Human Genome Sciences, Inc. | Human vascular endothelial growth factor 2 |
WO1997005250A2 (en) * | 1995-08-01 | 1997-02-13 | Helsinki University Licensing Ltd. Oy | Receptor ligand vegf-c |
WO1997009427A1 (en) * | 1995-09-08 | 1997-03-13 | Genentech, Inc. | Vegf-related protein |
WO1997017442A1 (en) * | 1995-11-08 | 1997-05-15 | Immunex Corporation | Flk-1 binding protein |
Non-Patent Citations (9)
Title |
---|
ACHEN, M.G., ET AL.: "VASCULAR ENDOTHELIAL GROWTH FACTOR D (VEGF-D) IS A LIGAND FOR THE TYROSINE KINASES VEGF RECEPTOR 2 (Flk1) AND vegf RECEPTOR 3 (Flt4)", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 95, January 1998 (1998-01-01), pages 548 - 553, XP002066364 * |
COHEN T ET AL: "VEGF121, A VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) ISOFORM LACKING HEPARIN BINDING ABILITY, REQUIRES CELL-SURFACE HEPARAN SULFATES FOR EFFICIENT BINDING TO THE VEGF RECEPTORS OF HUMAN MELANOMA CELLS", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 19, 12 May 1995 (1995-05-12), pages 11322 - 11326, XP002061896 * |
JELTSCH,M., ET AL.: "HYERPLASIA OF LYMPHATIC VESSELS IN VEGF-C TRANSGENIC MICE", SCIENCE, vol. 276, 30 May 1997 (1997-05-30), pages 1423 - 1425, XP002066365 * |
JOUKOV V ET AL: "A NOVEL VASCULAR ENDOTHELIAL GROWTH FACTOR, VEGF-C, IS A LIGAND FOR THE FLT4 (VEGFR-3) AND KDR (VEGFR-2) RECEPTOR TYROSINE KINASES", EMBO JOURNAL, vol. 15, no. 2, 1996, pages 290 - 298, XP002022272 * |
JOUKOV,V., ET AL.: "A NOVEL VASCULAR ENDOTHELIAL GROWTH FACTOR VEGF-C IS A LIGAND FOR THE FLT4 (VEGFR-3)AND KDR (VEGFR-2) RECEPTOR TYROSINE KINASES", EMBL SEQUENCE DATA LIBRARY, 1 February 1996 (1996-02-01), HEIDELBERG, GERMANY, XP002066362 * |
JOUKOV,V., ET AL.: "A RECOMBINANT MUTANT VASCULAR ENDOTHELIAL GROWTH FACTOR-C THAT HAS LOST VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-2 BINDING , ACTIVATION, AND VASCULAR PERMEABILITY ACTIVITIES", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 273, no. 12, 20 March 1998 (1998-03-20), pages 6599 - 6602, XP002066366 * |
JOUKOV,V., ET AL.: "PROTEOLYTIC PROCESSING REGULATES RECEPTOR SPECIFICITY AND ACTIVITY OF VEGF-C", THE EMBO JOURNAL, vol. 16, no. 13, June 1997 (1997-06-01), pages 3898 - 3911, XP002066363 * |
LEE, J., ET AL.: "vascular endothelial growth fator-related protein: a ligand and specific activator of the tyrosine kinase receptor flt4", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 93, March 1996 (1996-03-01), pages 1988 - 1992, XP002066360 * |
LEE,J., ETAL.: "VASCULAR ENDOTHELIAL GROWTH FACTOR RELATED PROTEIN (vrp): A LIGAND AND SPECIFIC ACITVATOR OF THE TYROSINE KINASE RECEPTOR Flt4", EMBL SEQUENCE DATA LIBRARY, 10 January 1996 (1996-01-10), HEIDELBERG, GERMANY, XP002066361 * |
Cited By (94)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7034105B2 (en) | 1992-10-09 | 2006-04-25 | Licentia, Ltd. | FLT4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy |
US7829091B2 (en) | 1992-10-09 | 2010-11-09 | Vegenics Limited | Therapy targeting FLT4 (VEGER-3) expressed in blood vessels |
US6824777B1 (en) | 1992-10-09 | 2004-11-30 | Licentia Ltd. | Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy |
US6734285B2 (en) | 1994-03-08 | 2004-05-11 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 proteins and compositions |
US7153827B1 (en) | 1994-03-08 | 2006-12-26 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 and methods of use |
US7576189B2 (en) | 1994-03-08 | 2009-08-18 | Human Genome Sciences, Inc. | Antibodies to human vascular endothelial growth factor 2 and methods of using the same |
US7109308B1 (en) | 1994-03-08 | 2006-09-19 | Human Genome Sciences, Inc. | Antibodies to human vascular endothelial growth factor 2 |
US7227005B1 (en) | 1994-03-08 | 2007-06-05 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US6608182B1 (en) | 1994-03-08 | 2003-08-19 | Human Genome Sciences, Inc. | Human vascular endothelial growth factor 2 |
US7115392B2 (en) | 1994-03-08 | 2006-10-03 | Human Genome Sciences, Inc. | Polynucleotides encoding human vascular endothelial growth factor 2 |
US7186688B1 (en) | 1994-03-08 | 2007-03-06 | Human Genome Sciences, Inc. | Methods of stimulating angiogenesis in a patient by administering vascular endothelial growth factor 2 |
US6040157A (en) * | 1994-03-08 | 2000-03-21 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7153942B2 (en) | 1994-03-08 | 2006-12-26 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7439333B2 (en) | 1994-03-08 | 2008-10-21 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7498417B2 (en) | 1994-03-08 | 2009-03-03 | Human Genome Sciences, Inc. | Antibodies to vascular endothelial growth factor 2 and methods of using same |
US8282931B2 (en) | 1995-08-01 | 2012-10-09 | Vegenics Pty Limited | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
US8637262B2 (en) | 1995-08-01 | 2014-01-28 | Vegenics Pty Limited | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof |
US6576608B1 (en) | 1995-09-08 | 2003-06-10 | Genentech, Inc. | Methods of using VEGF-related protein |
EP0848755B1 (en) * | 1995-09-08 | 2003-06-11 | Genentech, Inc. | Vegf-related protein |
US6451764B1 (en) | 1995-09-08 | 2002-09-17 | Genentech, Inc. | VEGF-related protein |
US7629145B2 (en) | 1995-09-08 | 2009-12-08 | Genentech, Inc. | VEGF-related protein |
US7507705B2 (en) | 1997-10-02 | 2009-03-24 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Methods for the modulation of neovascularization and/or the growth of collateral arteries and/or other arteries from preexisting arteriolar connections |
US8101188B2 (en) | 1997-10-02 | 2012-01-24 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Methods for the modulation of neovascularization and/or the growth of collateral arteries and/or other arteries from preexisting arteriolar connections |
EP1062319A4 (en) * | 1998-03-13 | 2003-04-23 | Human Genome Sciences Inc | Vascular endothelial growth factor 2 |
EP1062319A1 (en) * | 1998-03-13 | 2000-12-27 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
WO2000021560A1 (en) | 1998-10-09 | 2000-04-20 | Ludwig Institute For Cancer Research | Flt4 (VEGFR-3) AS A TARGET FOR TUMOR IMAGING AND ANTI-TUMOR THERAPY |
US8444957B2 (en) | 1998-10-09 | 2013-05-21 | Vegenics Pty Limited | Methods of screening for neoplastic disease states |
EP1568375A1 (en) * | 1998-10-26 | 2005-08-31 | Ludwig Institute For Cancer Research | Use of VEGF-C or VEGF-D gene or protein to prevent restenosis |
US6958147B1 (en) | 1998-10-26 | 2005-10-25 | Licentia Ltd | Use of VEGF-C to prevent restenosis |
US8455453B2 (en) | 1998-10-26 | 2013-06-04 | Vegenics Pty Ltd | Use of VEGF-D gene to prevent restenosis |
AU768330B2 (en) * | 1998-10-26 | 2003-12-11 | Vegenics Limited | Use of VEGF-C or VEGF-D gene or protein to prevent restenosis |
WO2000024412A3 (en) * | 1998-10-26 | 2000-08-03 | Ludwig Inst Cancer Res | Use of vegf-c or vegf-d gene or protein to prevent restenosis |
WO2000024412A2 (en) * | 1998-10-26 | 2000-05-04 | Ludwig Institute For Cancer Research | Use of vegf-c or vegf-d gene or protein to prevent restenosis |
WO2000027414A3 (en) * | 1998-11-06 | 2000-09-08 | Basf Ag | Inhibition of the formation of vascular hyperpermeability |
WO2000027414A2 (en) * | 1998-11-06 | 2000-05-18 | Basf Aktiengesellschaft | Inhibition of the formation of vascular hyperpermeability |
EP1140175A2 (en) * | 1998-12-21 | 2001-10-10 | Ludwig Institute For Cancer Research | Antibodies to truncated vegf-d and uses thereof |
US6730489B1 (en) | 1998-12-21 | 2004-05-04 | Ludwig Institute For Cancer Research | Antibodies to truncated VEGF-D and uses thereof |
EP1140175A4 (en) * | 1998-12-21 | 2003-03-05 | Ludwig Inst Cancer Res | Antibodies to truncated vegf-d and uses thereof |
EP1155117A4 (en) * | 1998-12-30 | 2003-05-14 | Millennium Pharm Inc | Secreted proteins and nucleic acids encoding them |
EP1155117A1 (en) * | 1998-12-30 | 2001-11-21 | Millennium Pharmaceuticals, Inc. | Secreted proteins and nucleic acids encoding them |
US7223724B1 (en) | 1999-02-08 | 2007-05-29 | Human Genome Sciences, Inc. | Use of vascular endothelial growth factor to treat photoreceptor cells |
US7524501B2 (en) | 1999-02-08 | 2009-04-28 | Human Genome Sciences, Inc. | Methods of treating an injury to, or disorder of, the eye involving photoreceptor proliferation by administering VEGF2 antibodies |
US7829536B2 (en) | 1999-03-26 | 2010-11-09 | Vegenics Limited | Method of treating lymphedema comprising administering VEGF-D |
US8357669B2 (en) | 1999-03-26 | 2013-01-22 | Vegenics Pty Limited | Method of treatment for lymphedema comprising administering a polynucleotide encoding VEGF-D |
US6764820B2 (en) | 1999-03-26 | 2004-07-20 | Ludwig Institute For Cancer Research | Screening for lymphatic disorders involving the FLT4 receptor tyrosine kinase (VEGFR-3) |
WO2001025277A1 (en) * | 1999-10-07 | 2001-04-12 | Maxygen Aps | Single-chain antagonist polypeptides |
EP2301579A1 (en) | 2000-01-28 | 2011-03-30 | Sunnybrook Health Science Centre | Therapeutic method for reducing angiogenesis |
US7740841B1 (en) | 2000-01-28 | 2010-06-22 | Sunnybrook Health Science Center | Therapeutic method for reducing angiogenesis |
US6965010B2 (en) | 2000-02-25 | 2005-11-15 | Licentia, Ltd. | Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins |
WO2001062942A3 (en) * | 2000-02-25 | 2002-03-21 | Ludwig Inst Cancer Res | MATERIALS AND METHODS INVOLVING HYBRID VASCULAR ENDOTHELIAL GROWTH FACTOR DNAs AND PROTEINS AND SCREENING METHODS FOR MODULATORS |
JP2004507208A (en) * | 2000-02-25 | 2004-03-11 | ルードヴィッヒ インスティテュート フォー キャンサー リサーチ | Materials and methods involved in hybrid vascular endothelial growth factor DNAs and proteins |
US7902149B2 (en) | 2000-02-25 | 2011-03-08 | Vegenics Pty Limited | Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins |
AU2001239884B2 (en) * | 2000-02-25 | 2006-08-10 | Vegenics Limited | Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins and screening methods for modulators |
US7566566B2 (en) | 2000-02-25 | 2009-07-28 | Vengenics Limited | Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins |
WO2001062942A2 (en) * | 2000-02-25 | 2001-08-30 | Ludwig Institute For Cancer Research | MATERIALS AND METHODS INVOLVING HYBRID VASCULAR ENDOTHELIAL GROWTH FACTOR DNAs AND PROTEINS AND SCREENING METHODS FOR MODULATORS |
US7309604B2 (en) | 2000-02-25 | 2007-12-18 | Licentia, Ltd. | Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins |
US7273751B2 (en) | 2000-08-04 | 2007-09-25 | Human Genome Science, Inc. | Vascular endothelial growth factor-2 |
US7026462B2 (en) | 2000-12-07 | 2006-04-11 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
US7605140B2 (en) | 2000-12-07 | 2009-10-20 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
US7067317B2 (en) | 2000-12-07 | 2006-06-27 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
US7560440B2 (en) | 2000-12-07 | 2009-07-14 | Sangamo Bioschiences, Inc. | Regulation of angiogenesis with zinc finger proteins |
US8071564B2 (en) | 2000-12-07 | 2011-12-06 | Sangamo Biosciences, Inc. | Regulation of angiogenesis with zinc finger proteins |
WO2002057299A2 (en) * | 2001-01-17 | 2002-07-25 | Ludwig Institute For Cancer Research | Vegfr-3 binding peptides and their use for inhibiting angiogenesis |
US7611711B2 (en) | 2001-01-17 | 2009-11-03 | Vegenics Limited | VEGFR-3 inhibitor materials and methods |
WO2002057299A3 (en) * | 2001-01-17 | 2003-05-08 | Ludwig Inst Cancer Res | Vegfr-3 binding peptides and their use for inhibiting angiogenesis |
US9260526B2 (en) | 2001-01-19 | 2016-02-16 | Vegenics Pty Limited | Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy |
US8940695B2 (en) | 2001-01-19 | 2015-01-27 | Vegenics Pty Limited | Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy |
US7402312B2 (en) | 2001-04-13 | 2008-07-22 | Human Genome Sciences, Inc. | Antibodies to vascular endothelial growth factor 2 (VEGF-2) |
US8216569B2 (en) | 2001-04-13 | 2012-07-10 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US9403905B2 (en) | 2001-04-13 | 2016-08-02 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US8784809B2 (en) | 2001-04-13 | 2014-07-22 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7208582B2 (en) | 2001-04-13 | 2007-04-24 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US7850963B2 (en) | 2001-04-13 | 2010-12-14 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US8206708B2 (en) | 2001-04-13 | 2012-06-26 | Human Genome Sciences, Inc. | Vascular endothelial growth factor 2 |
US9056138B2 (en) | 2002-03-01 | 2015-06-16 | Bracco Suisse Sa | Multivalent constructs for therapeutic and diagnostic applications |
US9629934B2 (en) | 2002-03-01 | 2017-04-25 | Dyax Corp. | KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy |
US8642010B2 (en) | 2002-03-01 | 2014-02-04 | Dyax Corp. | KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy |
WO2003080640A1 (en) * | 2002-03-07 | 2003-10-02 | Ludwig Institute For Cancer Research | Lymphatic and blood endothelial cell genes |
US7846437B2 (en) | 2004-03-05 | 2010-12-07 | Vegenics Limited | Chimeric anti-VEGF-D antibodies and humanized anti-VEGF-D antibodies and methods of using same |
US7732196B2 (en) | 2005-02-28 | 2010-06-08 | Sangamo Biosciences, Inc. | Anti-angiogenic methods and compositions |
US7795209B2 (en) | 2005-02-28 | 2010-09-14 | Sangamo Biosciences, Inc. | Anti-angiogenic methods and compositions |
US7893022B2 (en) | 2005-02-28 | 2011-02-22 | Sangamo Biosciences, Inc. | Anti-angiogenic methods and compositions |
US7358085B2 (en) | 2005-02-28 | 2008-04-15 | Sangamo Biosciences, Inc. | Anti-angiogenic methods and compositions |
US8012946B1 (en) | 2005-02-28 | 2011-09-06 | Sangamo Biosciences, Inc. | Anti-angiogenic methods and compositions |
EP2314614A1 (en) | 2005-02-28 | 2011-04-27 | Sangamo BioSciences, Inc. | Anti-angiogenic methods and compositions |
WO2007022287A2 (en) | 2005-08-15 | 2007-02-22 | Vegenics Limited | Modified vegf and pdgf with improved angiogenic properties |
US8025886B2 (en) | 2005-08-15 | 2011-09-27 | Vegenics Pty Ltd | Modified VEGF-A with improved angiogenic properties |
EP2548578A1 (en) | 2006-05-17 | 2013-01-23 | The Ludwig Institute for Cancer Research | Targeting VEGF-B regulation of fatty acid transporters to modulate human diseases |
EP2548579A1 (en) | 2006-05-17 | 2013-01-23 | The Ludwig Institute for Cancer Research | Targeting VEGF-B regulation of fatty acid transporters to modulate human diseases |
US9745558B2 (en) | 2013-02-18 | 2017-08-29 | Vegenics Pty Limited | VEGFR-3 ligand binding molecules and uses thereof |
US10494617B2 (en) | 2013-02-18 | 2019-12-03 | Vegenics Pty Limited | Ligand binding molecules and uses thereof |
US11866739B2 (en) | 2013-02-18 | 2024-01-09 | Vegenics Pty Limited | Ligand binding molecules and uses thereof |
WO2014182635A1 (en) | 2013-05-08 | 2014-11-13 | Baldwin Megan E | Biomarkers for age-related macular degeneration (amd) |
WO2023073526A1 (en) | 2021-10-25 | 2023-05-04 | Novartis Ag | Methods for improving adeno-associated virus (aav) delivery |
Also Published As
Publication number | Publication date |
---|---|
WO1998033917A9 (en) | 1999-09-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU748369C (en) | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof,and uses thereof | |
US6361946B1 (en) | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof | |
US20040147448A1 (en) | Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof | |
US6730658B1 (en) | Stimulation of lymphatic growth with an FLT4 ligand | |
WO1998033917A1 (en) | Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof | |
US6403088B1 (en) | Antibodies reactive with VEGF-C, a ligand for the Flt4 receptor tyrosine kinase (VEGFR-3) | |
US20030091567A1 (en) | Progenitor cell materials and methods | |
US6818220B1 (en) | Vascular endothelial growth factor C (VEGF-C) protein and gene mutants thereof, and uses thereof | |
EP2107109B1 (en) | Recombinant vascular endothelial cell growth factor D (VEGF-D) | |
US20140199302A1 (en) | Compositions for regulating iron homeostasis and methods of using same | |
AU2002300880B2 (en) | Vascular Endothelial Growth Factor C (VEGF-C) Protein and Gene, Mutants Thereof, and Uses Thereof | |
AU755708B2 (en) | Receptor ligand VEGF-C | |
Alitalo et al. | VEGF-C ΔR 226 ΔR 227 mutants and uses thereof | |
CN1242043A (en) | Receptor ligand VEGF-C | |
AU2007202554A1 (en) | Receptor Ligand VEGF-C |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA CN JP NZ US US US US US US US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1998904842 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2279554 Country of ref document: CA Ref country code: CA Ref document number: 2279554 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 533178 Kind code of ref document: A Format of ref document f/p: F |
|
AK | Designated states |
Kind code of ref document: C2 Designated state(s): AU CA CN JP NZ US US US US US US US |
|
AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
COP | Corrected version of pamphlet |
Free format text: PAGES 26 AND 88, DESCRIPTION, REPLACED BY NEW PAGES 26 AND 88; PAGES 1/15-15/15, DRAWINGS, REPLACEDBY NEW PAGES 1/16-16/16; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 62624/98 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09355700 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 1998904842 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 62624/98 Country of ref document: AU |